More Fields
Strain Species Genotype
GG25 C. elegans let-2(g25) X. Show Description
Temperature sensitive. Maintain at 15C. See also CGC 1806.
CY398 C. elegans daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
EG2537 C. elegans oxEx344. Show Description
oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.
IG256 C. elegans xnp-1(tm678) I. Show Description
Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.
NG2501 C. elegans epi-1(gm121) kyIs5 IV. Show Description
kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.
NG2517 C. elegans him-5(e1490) V; gmIs5. Show Description
gmIs5 [ina-1::GFP + rol-6(su1006)]. Rollers. ina-1(gm86) may still be in the background.
NG2535 C. elegans cam-2(gm124) I. Show Description
Recessive. Small, moderate Unc. 10% Muv. CAN cell migration defects. Clr.
OH14547 C. elegans pha-1(e2123) III; otEx6803. Show Description
otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
TG2519 C. elegans rip-1(tm2948) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Taylor MRG, et al. Cell. 2015 Jul 16;162(2):271-286.
TG2520 C. elegans pole-4(tm4613) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.