eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

Temperature sensitive. Maintain at 15C. See also CGC 1806.

Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.

domEx253 [mec-4p::Chrimson::GFP + unc-122p::RFP]. Pick animals with red fluorescence in coelomocytes to maintain. Red-light optogenetic line for gentle touch receptor neurons (TRN). Transgenic animals expressing the red light-activated channelrhodopsin Chrimson into TRNs using the mec-4 promoter. In animals grown on all trans-retinal-containing medium, red light stimuli trigger behaviors similar to those evoked by gentle touch. Note that very strong blue light stimuli may also activate Chrimson. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242.

oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.

Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.

kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.

gmIs5 [ina-1::GFP + rol-6(su1006)]. Rollers. ina-1(gm86) may still be in the background.

Recessive. Small, moderate Unc. 10% Muv. CAN cell migration defects. Clr.

otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

GFP::3xFlag inserted into endogenous laf-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

3xFlag::GFP inserted into endogenous glh-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

GFP::3xFlag inserted into endogenous gld-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

GFP::3xFlag inserted into endogenous deps-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

GFP::3xFlag inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

Superficially wild-type. Deletion site verified by PCR. Reference: Taylor MRG, et al. Cell. 2015 Jul 16;162(2):271-286.

Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.