Search Strains

Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc. Received new stock 11/2002.

mom-2(or77) is a recessive, non-conditional maternal-effect embryonic lethal. Weak allele of mom-2/Wnt (splice acceptor mutation in last exon (exon6). 8% of mutant embryos lack gut. Heterozygotes are Unc.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

Heterozygotes are Unc. Segregates Uncs (dpy-18 pie-1; skn-1/DnT1; eDp6), Dpy non-Uncs (dpy-18 pie-1; skn-1 with no Dp) which give only dead embryos, and DpyUncs (dpy-18 pie-1; skn-1/DnT1 with no Dp) which give only dead eggs, WT looking (dpy-18 pie-1; skn-1; eDp6) which give only dead embryos, and dead eggs.

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

Heterozygous. Pick Unc to maintain. Heterozygotes are Unc and segregate Unc heterozygotes, wildtype (or2015 homozygotes that give only dead progeny), and and arrested nT1 aneuploids. Pick Unc and check for correct segregation of progeny to maintain. or2015 is a CRISPR/Cas9-engineered null allele removing the entire apx-1 open reading frame. Reference: Chuang CH, et al. G3 (Bethesda). 2025 Sep 26:jkaf229. doi: 10.1093/g3journal/jkaf229. PMID: 41004705.

Heterozygotes are Unc.

mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]

Maintain at 15C. Animals are Unc.

Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.

Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys segregate only embryonic lethals which lack endoderm and make excess mesoderm with E adopting and MS-like fate. or42 is a recessive maternal-effect lethal.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

Heterozygotes are WT and segregate WT, Uncs and Rollers. or78 zygotic effects: Pv, mild Unc, many explode at vulva upon reaching adulthood. or78 maternal effects: endoderm (E) transformed into mesoderm (MS) in early embryo, severe morphogenesis defect. mig-14, mom-3, pvl-2, and let-553 are the same gene.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

mom-2(or33) is a recessive, non-conditional maternal-effect embryonic lethal. Intermediate strength allele; missense mutation near C-terminus: C321Y. 50% of mutant embryos lack gut. Heterozygotes are Unc.

Heterozygotes are WT and lay 10/16 dead eggs. spn-4 unc-42 homozygotes are Unc and lay dead embryos exhibiting defects in mitotic spindle orientation and cell fate patterning. spn-4(or25) homozygotes are non-conditional maternal effect embryonic lethal.

Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.

Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.

Heterozygotes are Unc and segregate Uncs, WT which give only dead eggs, and dead eggs. or309 is a deletion allele: removes exon 4 to 3' end and leave about 100 N-terminal amino acids.

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

Egl. Low penetrance embryonic lethal. mig-14, mom-3, pvl-2, and let-553 are the same gene.

Homozygous viable and fertile, but slow growing, transparent and small. Originally from BC4253 but outcrossed an additional 7 times.

Heterozygotes are Unc and segregate Sterile non-Unc (homozygous for ar228) and dead eggs. ar228 have severely reduced germline proliferation, which is more severe at 15C than at 25C.

naEx57 [lag-2p::FLP::let-858 3'UTR + ceh-22p::GFP]. Him. Derived by injection of plasmids pGC158 and pCW2.19. Reference: Voutov, R and Hubbard, EJ. Genetics 180(1):103-19 (2008).

naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].

naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1440 previously called mel-27.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Temperature sensitive. Maintain at 15C. See also CGC 1806.

Temperature sensitive. Maintain at 15C. No growth at 20C. See also CGC 1806.

Temperature sensitive. Maintain at 15C. See also WBPaper00001806.

Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.

N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.

N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.

N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.

Animals heterozygous for mnDp33 are Lon and segregate Lon and larval lethals. (Animals which have lost mnDp33 are larval lethal. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).)