Search Strains

reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of TSR-2 in epidermal tissues. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in epidermal tissues. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at the C-terminus of the endogenous rpoa-1 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-1 and UNC-104 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/

Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.

orEx1[act-2 promoter::GFP::act-2 genomic fusion + rol-6(su1006)]. Shows cytoplasmic and cortical ACT-2::GFP expression in early embryonic cells, in epidermal cells during embryonic elongation, and in body wall muscle cells and some neurons in adults. All expression is zygotic; no germline expression is detected for this trangene even though act-2 is maternally expressed. Maintain by picking Rollers.

Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exon and extending beyond the 3' UTR.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive. Viable at 15C. Complete loss of aspm-1 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311. PMID: 24554763

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 25C to retain transgene fluorescence. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

sas-7(or1940[gfp::sas-7]) III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Green centriole signal and red chromosome signal. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sugioka, et al., 2017 Elife 6 e20353.

ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.

ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 15C. Fast-acting temperature-sensitive allele. At restrictive temperature (26C), animals give rise to 100% dead embryos. At 15C, animals give rise to viable progeny. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Might still carry unc-119(ed3) III in background. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.

cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.

Hypersensitive to copper and cadmium ions, and to starvation. [NOTE: Prior studies suggested possible cross-regulation of PMK-1 by MEK-1, but the identification of a tightly linked partial loss-of-function mutation in sek-1(qd127) in the strain carrying the mek-1(ks54) mutant allele (K. Reddy and D. Kim, unpublished data) suggests that the diminished PMK-1 activation observed in this mutant strain may actually be due to diminished SEK-1 activity.]

xnIs506 [cdc42p::GST::GFP::wsp-1(GBD) + unc-119(+)]. Biosensor for active CDC-42. In epithelia, GFP is enriched at junctions between epithelial cells. Some signal is in the nucleus (this signal is reduced by addition of GST, which makes the transgenic protein larger). Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

Superficially wild type. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT and segregate WT, Mec and larval lethals. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. 775 bp deletion. 24926/24927 - 25701/25702. Primer 1: att gcc aat gcc gtt ctt cc (forward primer to the left of deletion). Primer 2: tat tat ttc gcg tcg gag cg (forward primer lies in the deletion). Primer 3: att tat gca gga gcg gca ag (reverse primer to the right of deletion). In sod-5(+) you see 720 bp product with primer 2 and 3. reliable PCR. in sod-5(+) expected product size is 1315 bp with primer 1 and 3. not always reliable. In sod-5 (tm1146) you see 540 bp product with primer 1 and 3. reliable PCR. In sod-5(tm1146), you see no product with primer 2 and 3. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807