Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
EU3169 C. elegans zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3201 C elegans klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU365 C. elegans mom-2(or85) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]
EU828 C. elegans dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
EW15 C. elegans bar-1(ga80) X. Show Description
[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.
FAS32 C. elegans his-74(uge16[gfp::his-74]) V. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS34 C. elegans his-74(uge18) V. Show Description
Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS43 C. elegans his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS46 C. elegans his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS47 C. elegans his-70(uge31[gfp::his-70]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS65 C. elegans his-69&his-70(uge44) III. Show Description
Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS84 C. elegans his-71(uge45[gfp::his-71]) X. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FGP30 C. elegans gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
FJ1519 C. elegans cdk-5(gm336) III. Show Description
cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.
FK171 C. elegans mek-1(ks54) sek-1(qd127) X. Show Description
Hypersensitive to copper and cadmium ions, and to starvation. [NOTE: Prior studies suggested possible cross-regulation of PMK-1 by MEK-1, but the identification of a tightly linked partial loss-of-function mutation in sek-1(qd127) in the strain carrying the mek-1(ks54) mutant allele (K. Reddy and D. Kim, unpublished data) suggests that the diminished PMK-1 activation observed in this mutant strain may actually be due to diminished SEK-1 activity.]
FT1459 C. elegans unc-119(ed3); xnIs506. Show Description
xnIs506 [cdc42p::GST::GFP::wsp-1(GBD) + unc-119(+)]. Biosensor for active CDC-42. In epithelia, GFP is enriched at junctions between epithelial cells. Some signal is in the nucleus (this signal is reduced by addition of GST, which makes the transgenic protein larger). Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.
FX1053 C. elegans ins-11(tm1053) II. Show Description
Superficially wild type. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX11364 C. elegans pps-1(tm1109)/mec-3(u297) IV. Show Description
Heterozygotes are WT and segregate WT, Mec and larval lethals. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX1146 C. elegans sod-5(tm1146) II. Show Description
Homozygous viable. 775 bp deletion. 24926/24927 - 25701/25702. Primer 1: att gcc aat gcc gtt ctt cc (forward primer to the left of deletion). Primer 2: tat tat ttc gcg tcg gag cg (forward primer lies in the deletion). Primer 3: att tat gca gga gcg gca ag (reverse primer to the right of deletion). In sod-5(+) you see 720 bp product with primer 2 and 3. reliable PCR. in sod-5(+) expected product size is 1315 bp with primer 1 and 3. not always reliable. In sod-5 (tm1146) you see 540 bp product with primer 1 and 3. reliable PCR. In sod-5(tm1146), you see no product with primer 2 and 3. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX11501 C. elegans dpy-5(e61) uri-1(tm939)/dpy-5(e61) unc-14(e57) I. Show Description
Heterozygotes are Dpy. Segregate Dpy Unc. tm939 homozygotes are emb, leth, pvl, rup, larval arrested or sterile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX11507 C. elegans rabs-5(tm2036) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested nT1 aneuploids, and non-GFP tm2036 homozygotes. tm2036 homozygotes are temperature sensitive lethal, and can be maintained as homozygotes at 15C. tm2036 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX11552 C. elegans vps-45(tm246)/egl-17(e1313) lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, Egl Lon, and tm246 homozygotes (temperature sensitive lethal which can be maintained as homozygotes at 15C). tm246 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX1524 C. elegans cku-70(tm1524) III. Show Description
Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX19134 C. elegans tmIn8 II. Show Description
Break points: In(F13D12.6 Y51H1A.2) II. Covered region (Mb) 2.1 (11.7..13.9) Obtained by TMP/UV. (Note: Y51H1A.2 has been renamed cup-14.) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19163 C. elegans mca-3(tm6395)/tmIn11 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19171 C. elegans lig-4(tm750) III; tmIn26 X. Show Description
tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19173 C. elegans lig-4(tm750) III; tmIn19 V. Show Description
Break points: In(unc-23 lon-3) V. Covered region (Mb) 3.3 (8.9..12.2) Lon Unc. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19181 C. elegans unc-15(tm6329)/tmIn14 I. Show Description
Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1). Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type heterozygotes, Dpy (tmIn14 homozygotes), and unc-15 homozygotes. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19472 C. elegans tmIn10 II. Show Description
Break points: In(ZK1240.1 F29A7.8) II. Covered region (Mb) 0.4 (2.3..2.8) Obtained by TMP/UV. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19585 C. elegans lig-4(tm750) tmIn52 III. Show Description
Break points: In(hpr-9 ttr-52) III. Covered region (Mb) 2.8 (10.6..13.4) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19702 C. elegans lig-4(tm750) III; tmIn54 V. Show Description
Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19704 C. elegans tmIn58 I; lig-4(tm750) III. Show Description
Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19706 C. elegans lig-4(tm750) III; tmIn60 X. Show Description
Break points: In(odr-7 F59F4.2) X. Covered region (Mb) 3.4 (12.5..15.8) Unknown if tmIn60 homozygotes are Odr. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19992 C. elegans lig-4(tm750) III; tmIn62 IV. Show Description
Break points: In(kvs-5 dmd-9) IV. Covered region (Mb) 2.5 (0.7..3.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX2066 C. elegans his-72(tm2066) III. Show Description
Homozygous viable and fertile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2355 C. elegans ift-81(tm2355) X. Show Description
Superficially WT. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2394 C. elegans ift-74(tm2394) II. Show Description
Superficially WT. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX291 C. elegans +/eT1 III; spn-4(tm291)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. 1/3 of WT animals (spn-4 homozygotes) are Mels: segregate only dead embryos with have no morphogenesis. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2956 C. elegans mps-4(tm2596) III. Show Description
Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX301 C. elegans gsp-2(tm301) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maintain by picking wild-type GFP+. Heterozygotes are WT GFP+ and should segregate WT GFP+ heterozygotes, non-GFP gsp-2 homozygotes (embryonic lethal), very rare GFP+ homozygous hT2, and dead eggs. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX30225 C. elegans tmIn65 I; lig-4(tm750) III. Show Description
Break points: In(dnj-27 dkf-1) I. Covered region (Mb) 1.8 (11.9..13.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30262 C. elegans lin-42(tmIs1246) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::Venus. Egl. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30266 C. elegans lin-42(tmIs1226) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30269 C. elegans dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX536 C. elegans ced-13(tm536) X. Show Description
Deletion allele. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX544 C. elegans cdc-48.1(tm544) II. Show Description
Received new stock 10/30/08. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX546 C. elegans sqv-5(tm546)/unc-55(e402) I. Show Description
T24D1.1 Heterozygotes are wild-type and segregate wild-type heterozygotes, unc-55 homozygotes, and sqv-5 homozygotes (sterile, clear, sickly). Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX627 C. elegans lgc-11(tm627) X. Show Description
No obvious phenotype. 446 bp deletion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX659 C. elegans cdc-48.2(tm659) II. Show Description
Received new stock 10/30/08. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX683 C. elegans spas-1(tm683) V. Show Description
Superficially WT. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807