Search Strains

Homozygous viable. 612 bp deletion. 17154/17155 - 17766/17767. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Received from Limor Broday. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

No obvious phenotype. 625 bp deletion + 7 bp insertion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes segregate wild-type heterozygotes, Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain replaces LG100. Reference: Burnett C, et al. Nature. 2011 Sep 21;477(7365):482-5.

Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1433 homozygotes that produce arrested embryos (approximately 100 cells). GE1713 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1470 homozygotes that produce arrested embryos. GE1735 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1461 homozygotes that produce dead eggs. GE1742 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1738 homozygotes that produce dead embryos. GE1936 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1745 homozygotes that produce dead eggs at restrictive temperature. GE1939 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1726 homozygotes that produce dead embryos. GE1958 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Temperature-sensitive maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2021 homozygotes that produce dead eggs at restrictive temperature. GE2047 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1480 homozygotes that produce dead eggs. GE2200 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1614 homozygotes that do not produce viable progeny. GE2237 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1496 homozygotes that do not produce viable progeny. GE2277 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1867 homozygotes that do not produce viable progeny. GE2305 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2056 homozygotes that produce dead eggs. GE2335 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1932 homozygotes that produce dead embryos. GE2391 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1559 homozygotes that produce arrested embryos. GE2399 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Wild type at 15C. Embryonic lethal at 25C. Temperature sensitive phase during embryogenesis. sup-35 mutations may (and have) occurred spontaneously in this strain. This can be checked by shifting the worms to 25C: pha-1 animals should be dead while sup-35 pha-1 animals will live.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1900 homozygotes that produce dead embryos. GE2453 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2035 homozygotes that produce dead eggs. GE2541 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1693 homozygotes that do not produce viable progeny. GE2666 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1786 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2827 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1866 homozygotes that produce unfertilized oocytes at restrictive temperature. GE2895 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Sterile at 25C, maintain at 15C. NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2141) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in WBG article by Dalfó D, Priess J, Schnabel R and Hubbard J. (2010) [glp-1(e2141) sequence correction. The Worm Breeders Gazette. 18-3.], e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

DpyUnc. At 25C ar22 recessively suppresses the Egl defect of n676n930. At 15C ar22 dominantly suppresses the 2 AC-Egl phenotype of n676n930. Suppresses the vulval lineage defects and proximal mitosis defects of lin-12. Do not distribute this strain; other labs should request it from the CGC.

Egl. Unc. Do not distribute this strain; other labs should request it from the CGC.

Temperature sensitive maternal effect lethal if shifted from 15C to 25C at the L4 and later stages; sterile if it gets past embryogenesis before being shifted. Maintain at 15C. MJ61 contains a lin-12 allele (ar170) which results in 2 anchor cells. GS1369 was derived by outcrossing MJ61 to remove ar170. Do not distribute this strain; other labs should request it from the CGC. Added 10/2005: Zhuoyu Ni in Sylvia Lee's lab did not find the published missense mutation in this strain. It does have the ts sterile/lethal phenotype still.

Pick non-Uncs to maintain. arDp2 is derived from mnC1, hence carries dpy-10(e128) and possibly unc-52(e444). arDp2 is a free duplication but does not pass at a high frequency. arDp2 is not stable as a balancer. It is prone to recombination; pick non-Unc and check for segregation of unc-4 and WT in progeny. Do not distribute this strain; other labs should request it from the CGC.

arIs36 [(pJF43) hsp::ssGFP + dpy-20(+) + pBluescript SK+]. GFP is secreted into the pseudocoelom upon heat shock and is taken up by coelomocytes. Not known where arIs36 is attached. Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.

Egl. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. GFP is secreted from muscle cells. Do not distribute this strain; other labs should request it from the CGC.

Animals with the duplication are WT and segregate WT and larval lethals. Larval muscle detachment and arrest at about L1 stage in mua-3(ar62) homozygotes. Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.

Animals with the duplication are WT and segregate WT and dead eggs. 3-fold muscle dettachment and arrest in 90% of mup-4(ar60) homozygotes; 10% arrest earlier. Do not distribute this strain; other labs should request it from the CGC.

WT. Suppresses the egg-laying defect of lin-12(n302). Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.