Search Strains

Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1539 [spd-2p::GFP::spd-5 S170A T178A T198A::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled microtubules. GFP-labeled centrosomes. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.

mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281

Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447

GFPnovo2 inserted at N-terminus of endogenous nep-2 locus. Expression in muscle, including uterine and vulval muscles, as well as several neurons and other tissues. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.

Molecular null allele. syb5866 is a CRISPR-engineered deletion of the entire flp-11 coding region. Strongly reduces sleep. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

(III:7007600). FLP D5 recombinase driver expressed from the flp-11 promoter. The flp-11p::FLP driver consistently causes recombination in RIS, as well as in several other cell types. It is more penetrant but less specific than srx-9(syb7929[srx-9::SL2::FLP D5]). Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

FLP D5 recombinase driver expressed from the nmr-1 locus. nmr-1::SL2::FLP causes recombination in command interneurons including AVA, AVD, AVE, RIM, AVG, PVCs. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

srm-1(syb8127[dpy-10 sgRNAsite::unc-25 fragment with tataa sites::dpy-10 sgRNAsite::SL1-aaaa::FLP D5::let-858 3’utr]) (IV:5015000). FLP D5 recombinase driver expressed from a fragment of the unc-25 promoter that expresses in RME neurons. Recombination was only modestly penetrant. Promoter construct contains dpy-10 sites allowing for a straightforward exchange of the promoter. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

FLP D5 recombinase driver expressed from the unc-4 locus. unc-4::SL2::FLP causes recombination specifically in Dorsal A-type motor neurons, SABs neurons and I5. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53F4B.28 Homozygous. Outer Left Sequence: acctaagccaagccctaagc. Outer Right Sequence: gacctgagaaaatgcaaggc. Inner Left Sequence: gcctaagcctgtgcctaaaa. Inner Right Sequence: tttggacagctttaattccga. Inner Primer PCR Length: 1185. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53F4B.20 Homozygous. Outer Left Sequence: aatcgatatccagcaaaccg. Outer Right Sequence: cggcaaatcggtaaacagtc. Inner Left Sequence: tccggaaaattgtggttttg. Inner Right Sequence: ggaattgaaaatttccggc. Inner Primer PCR Length: 1252. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

mScarlet and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.

mNeonGreen and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.

This strain carries endogenously tagged dynein heavy chain (mCherry::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038

This strain carries endogenously tagged dynein heavy chain (egfp::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038

he278 is a CRISPR-induced deletion of ebp-2. he279 is a deletion removing ebp-1, Y59A8B.25 & ebp-3. Low penetrance of pleiotropic phenotypes among adults, including low frequency of dumpy, sterile and/or uncoordinated animals and nonviable larvae that explode through the vulva. Some adults develop irregularities that seem to represent epidermal bulges. Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038

GFP tag inserted into endogenous pcmd-1 locus. Reference: Erpf AC, et al. Curr Biol. 2019 Apr 22;29(8):1324-1336.e6. doi: 10.1016/j.cub.2019.03.029. PMID: 30982652

Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 1043 bp. Deletion left flank: TTTCTTTGTACAAAAACCATCACCAGCCTC. Deletion right flank: GAAATTTTGAACATCGAACCAACTATCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 879 bp. Deletion left flank: TCCAGCCCCGAGAAAGCCTAAACTTAAGTA. Deletion right flank: TTTTTTGGGTATGTTCTTTTTGGACCCCCATAACTTTTTTGAGAACAAGTTTCAGATAA TTTTTTTTCGATGAAATTTTAGTCAAATACTTGATTAACATTATCTCCATAAAAAATCA TATTAATAGCTCGTTGGCGCCGTGGGCTGGAACGCGAAAAAAACTTCCCATAATTAATT GTCACCCTGTATATGTATATATGTAATCATATGCACGTATATGTATAATTGATATGTAA TAGATATGTATAACCTATATGTATATAGTAATACATATGTTCAAAACCTAGTAGTATTA TATAAACCTAGTATAGAATATTACCATAACTAGTACCTACCTATGTATATGTATAAAAT ATGATGCCATGATCAGACTGAATGGTAGGTTAATCATCAATCAAAAAATTACTTCAAAA TAATACCCCGGTTTCAGTTATACACCATAACGCCGAATTCAGTAAGCCTATTGTTGGTT TTCGGTAGTTAGTGAATAAACTTATTATTATTATTATTATTATTTGGGTGTATATCTTA TATCATACTATTTTATACATGTTCTTATTAAGGAAAAGGTTTATTTCGTTGCACCTCTG ATTACGGCTCAAAAACCTACCTGTAAATTCGGTAGGATTGACAATATATCCCCTAGTCG AATTGACGAATCTAATTCTGATCTCGTCAGCTTGGAGTACTGTAGAACTTCCCGCTGCA CGGATTCCCGAATCCTTCTGCATGATTCTGTGCATTGATCGGACTGGCCTTCTAGCCCC GTGTCGAATAGAGTTAAGGCTGTTAGAGCCAGAAATTCGAATTTGTCACACGCAATTCG GATCATTGGATCGTACACATTGCGGCGGTAAGTGTCGAATGAGCTGGCGAACATTCTGG AAAATTTTTTAAATCGGCAAAGATATTTGAATAGATTCCTACTTGGAAGCTTCTACCTC GGAAATTGGCTGTTGTCCATCTGGATCGTGATAATACGTTTCTGGATTCACACAATCAA TATAATCACCAGATGGTAGGTAGGTAATGTCTGTTCTGCCATATTGACATGCGAAATAG CCACCTTCGAGGATGATGAATTGTAGGTAGAAGTTGTGGAGCAGGGTTGTCTGAAAGAA TTCGAGGTATGGACTTTGGACAGGGTAAGCATTCTTGGACAGACTCTAAGCAGGCTTTT GCCAAATAACGAGCAGAACTTTACTCGACCAGGCTGGGAAAGATTTGGACCAGAATTGG TCCTGATATTGTTCAACTCTTCGCTTGGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1795 bp. Deletion left flank: AAAGACGAAATTGAGAAGAAAATTGCTGAG. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: AAAATTTGATACTTTTTGATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1350 bp. Deletion left flank: AATGGACCTGAAAGATTGAAAACAATTGAC. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: GTGTGGTAAGCGAAAGTAAGCGAAAATTCAAGCTTCGATTGAATTATCATTTCAAAAAG AAATAAATGGAAAACGTATTGTAATCGCTGAACAAACTCCAAAAAATTTGATACTTTTT GATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13B5.5, T13B5.6, T13B5.7, Y53F4B.25, Y53F4B.27, F55C5.6, F55C5.7. The allele gk1208 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AACTTCGGGAATGTCAATGC. External right primer: CAATTTTGGACCAACCCAAT. Internal left primer: GCCAGAGACCTTCCACAGAG. Internal right primer: ACTTTCAATTTCCGGACGTG. Internal WT amplicon: 2542 bp. Deletion size: 1329 bp. Deletion left flank: TCCCGGTTCTACGAATTCCAGAAGTAATAT. Deletion right flank: CTTCAGCTCTTTGAGCCGTTGCCACTAGCT. The allele gkDf19 was identified by CGH but not confirmed by PCR. Left flanking probe: AATGTGGAAAAGGGCTACTCGCTTGTCTATGCTGAAACGTAGGTTGTGAA. Right flanking probe: CACTTCATCTCAAGATTTCGTTGAGAAGTGTCGGTTGTATTGCCCCATGT. Left deleted probe: GATCTGGCAAAATGTTGTTGAAAACTTAAATTTTTCCACCAAGTTTTTGT. Right deleted probe: AATTGGGGATCCTTCTCCATGTGCCACAATATCAACCTGATTATTCGTAA. The allele gkDf20 was identified by CGH but not confirmed by PCR. Left flanking probe: ATGCTGTGAACGTGCTGGAATTCTATCGTTCCAAGGCGGAAAATGTATTC. Right flanking probe: GAAACTATGCGATTCGAGTGGAGAATAAGAAAAAGTCATCGTTGATTTCT. Left deleted probe: ATGTATTCCATTCTGTCGAACCCACGTGGCAACTCCTTCAAATGTTTTCG. Right deleted probe: TGGGAAAAGCCGGCCACCGCCATCTGGAAACTATGCGATTCGAGTGGAGA. The allele gk3058 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAAACCACTCTGGAAGACGATTTCATGGTTTTCGAGCCCAGTTCATGG. Right flanking probe: AATTCACTGTTTACCACTCTGTGAACCTGGATGTGTCAAGGGGTGCGACC. Left deleted probe: TGTTTATATTCCTGGAAACAGCATATAACCTTCTCTGTAGATTCAACGAT. Right deleted probe: AGTGTACAAGTGGCAGGTCACAACAGTATACTCTACGTACCAACTTCCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3116) in Y41D4B.21, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 444 bp. Deletion left flank: ACCTCATTAGTGACAGCTCTTCGAAAGAAT. Deletion right flank: CAATTTTTTCAGACATTTTTCTGATCTCGT. Insertion Sequence: AAA. Validation: No CGH probes for gk3116. Other deletions (gkDf36, gkDf37) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 697 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTATCAACGAAAAATCTTCACAGTTCCA; Right flanking sequence: AGAACTAAGATAAGTGCTATTCCATCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Y92C3B.2a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

hpIs600 [myo-3p::GCaMP6::wCherry + lin-15(+)]. GFP and RFP in body wall muscles. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.