Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
SV1450 C. elegans unc-119(ed3) III; heIs145 IV Show Description
heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1462 C. elegans unc-119(ed3) III; heSi149 X. Show Description
heSi149 [myo-3::CRE::tbb-2 3'UTR + unc-119(+)] X. Inserted at ttTi14024. Maintain at 15-25C. Expression of CRE recombinase in differentiated body wall muscle cells driven by the myo-3 promoter. [NOTE: this stock serves as a replacement for SV1461, which was found to be carrying an unidentified red fluorescent transgene in the background.] Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1578 C. elegans unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1871 C. elegans swsn-4(he268 he272 [LoxN start + LoxN intron 5]) IV; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
SV1930 C. elegans swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
SV2061 C. elegans he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II; e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Show Description
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.
SX1287 C. elegans mjIs145 II; unc-119(ed3) III. Show Description
mjIs145 [mex-5p::GFP::his-58::21UR-1sense::tbb-2 3'UTR] II. Control piRNA sensor strain accompanying SX1316. Instead of antisense 21UR-1 target site, this transgene contains the piRNA sequence in sense and histone GFP is not silenced. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
SX1316 C. elegans mjIs144 II; unc-119(ed3) III. Show Description
mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
SX3073 C. elegans mjIs588 II; unc-119(ed3) III Show Description
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
TBD307 C.elegans dhc-1(he255[epdz::mCherry::dhc-1]) I; utdSi51 II. Show Description
utdSi51[mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3’UTR] II. Maintain at 23C and protect from light. Strain is sickly, seems to grow best and lay more eggs at 23C. Upon stimulation with 488nm light, the LOV-ePDZ optogenetic system will recruit mitochondria to the dynein heavy chain in the worm embryo. Embryonic cell divisions can be stopped by if mitochondrial recruitment is stimulated in early development. Room light can also induce mitochondria re-localization and cause infertility; store this strain in the dark. Reference: Fan X, et al. G3 (accepted).
TY3558 C. elegans unc-119(ed3) ruIs32 III; ojIs1. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.
UX993 C. elegans jnSi12 II; ezIs2 III; ltIs37 IV. Show Description
jnSi12 [peel-1p::htas-1::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)] II. ezIs2 [fkh-6::GFP + unc-119(+)] III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP expression in spermatheca. mCherry expression in germline nuclei. UX993 sperm have increased mCherry intensity compared to that of its parent strains. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
VC1179 C. elegans F08B12.1(gk545) X. Show Description
F08B12.1. External left primer: CTCCTCCTACACCCTCTCCC. External right primer: CGCTAAGCTTGTGTTGGTCA. Internal left primer: GAAGCCGCTAGAAGAACGTG. Internal right primer: ATTTAGGTACGCGCGAGAAA. Internal WT amplicon: 2016 bp. Deletion size: 569 bp. Deletion left flank: CCTTATAAATCCGCGGAGCAATACAAATGT. Deletion right flank: ATCTTCGCAAATCAACTCAGCAAACACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1359 C. elegans K02B12.3(ok1827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1827 homozygotes (probable embryonic/early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATGGAGAAGGATGGACCC. External right primer: TGGAACAAGAACCGGAAAAC. Internal left primer: TGAGAAATAGTGAAGCGCGA. Internal right primer: CTATTTGAACACCCGCCAAT. Internal WT amplicon: 2550 bp. Deletion size: 1420 bp. Deletion left flank: AAAATTCGGATTTAATTATTTAGATAGAAG. Deletion right flank: CCACGTGTTCTCGTTGAAAATCGCTTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1441 C. elegans ceh-6(gk665) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk665 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 1525 bp. Deletion left flank: GAAGGTACATTAGTGAATAGGAAAATAATA. Deletion right flank: AGACATTGATGCTGTAGAATTGTGAAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1481 C. elegans ceh-6(gk679) I. Show Description
K02B12. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 508 bp. Deletion left flank: AGCGGTCTTTCTGCGTCTCGTCTAGCCACC. Deletion right flank: GTTACGTATTGACAACCTGGTGAAAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1613 C. elegans T15B12.1(gk751) III. Show Description
T15B12.1. External left primer: AAAAATTGCCAGAATCGTCG. External right primer: CAAAGGCGGTTTGTGAAAAT. Internal left primer: ATTGGCAATCTCCGTTCATC. Internal right primer: GTTAACAGCCAGATGCTCCC. Internal WT amplicon: 1544 bp. Deletion size: 622 bp. Deletion left flank: TGTGTTCTTTTGATTAATTGATATGCATTC. Deletion right flank: ACACTTCCAAATCGTCCAAATATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1656 C. elegans nhr-13(gk796) V. Show Description
Y5H2B.2. External left primer: CCCAGTGGAATGCAACTTTT. External right primer: TTGCATTCTCCTCGTAGCCT. Internal left primer: CGAGTGGAATTCTGAGAGCA. Internal right primer: CGAGACGGTAGCAGAAGACC. Internal WT amplicon: 2106 bp. Deletion size: 320 bp. Deletion left flank: TTTGCATTTATTTGCGTTTTTTTGGCTATA. Deletion right flank: TCAGTGTATTGACCAACCGGATGCCTGTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1657 C. elegans uaf-1(gk800) III. Show Description
Y92C3B.2. External left primer: ACCGGTTACTGTAGGCATCG. External right primer: TCGGTGATTTTGGTGTGAAA. Internal left primer: AGCGTTATTTGCTGCGATTT. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1809 bp. Deletion size: 737 bp. Deletion left flank: GTTTTGCCATGAAAAAGTGCAAATTTAGGT. Deletion right flank: TCAATTTTTCGCTCTAAAATCGAATTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC167 C. elegans tbb-2(gk130) III. Show Description
C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC169 C. elegans tbb-2(gk129) III. Show Description
C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1700 C. elegans +/szT1 [lon-2(e678)] I; asb-2(ok2029)/szT1 X. Show Description
F02E8.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2029 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTCACCTCTTTCCCAATCCA. External right primer: AGGTTTTGTGGCTGACGAAT. Internal left primer: CTAAACGACACTCCGCTGGT. Internal right primer: GCCACAGAAATGTGGCTTTT. Internal WT amplicon: 2129 bp. Deletion size: 1155 bp. Deletion left flank: GACTGCAACAAGGAATGGTCTGCTCCAGAA. Deletion right flank: ACTTTAAATACGAGATGAAAAAAGGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1819 C. elegans slo-2(ok2214) X. Show Description
F08B12.3. External left primer: CCGAAGTTAAATATCCGCCA. External right primer: AAGGACCCCAATTTTCCACT. Internal left primer: ATGAACGGCATATGAGAGCC. Internal right primer: TCGCCAGAAAATTGAAAACA. Internal WT amplicon: 3098 bp. Deletion size: 1008 bp. Deletion left flank: TAAATCATGCACTGGTCTGTAGTATGCTCG. Deletion right flank: CTTCTGAAAGAATGTATGTAATCATCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1832 C. elegans ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1859 C. elegans Y67D8B.2(gk894) IV. Show Description
Y67D8B.2. External left primer: GGAAAAGCAGACAACCTTGC. External right primer: AAGCCTGCCTAACGACTTGA. Internal left primer: GAGATTCCAGCAAGCCACTC. Internal right primer: GGGTGCCACTAATCGCTAAA. Internal WT amplicon: 1761 bp. Deletion size: 485 bp. Deletion left flank: CATTTGGGTCGAGGCTACTGGATTCATCTG. Deletion right flank: CCTATATGCCTACGTGTTAGGTCGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1911 C. elegans C01B12.2(gk1032) II. Show Description
C01B12.2. External left primer: AGACGCCATGATTTTCAACC. External right primer: AACCGTAATGGGACAGCTTG. Internal left primer: GAACCTGCGGTTCAAACAAT. Internal right primer: AGGGAGTGAGCGAGAAACAA. Internal WT amplicon: 2259 bp. Deletion size: 561 bp. Deletion left flank: AAACGTGGTTTTGCCCGAGTTCTCTGAAAC. Deletion right flank: AAGCAATTTACTCAAATTATTTCAGTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2082 C. elegans srab-2(gk686) V/nT1 [qIs51] (IV;V). Show Description
C04F5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk686 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTCAGACCCGCTTTGAGAA. External right primer: CAAACATGGTGCAAGACCAG. Internal left primer: CGAAGAATGCTTGCAAATGA. Internal right primer: TCCTTCGAGCCAGCTGTATT. Internal WT amplicon: 2299 bp. Deletion size: 1150 bp. Deletion left flank: AAGAAACTCTTTTGAGTTACCTCATTTTTT. Deletion right flank: TTTCTCCACGCTACTCCGACACATTATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2133 C. elegans C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2148 C. elegans F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). Show Description
F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2154 C. elegans F16B12.5(gk1009) X. Show Description
F16B12.5. External left primer: AATTGTACGGCGGAAAACTG. External right primer: ACCACGGTTGCATAGGACTC. Internal left primer: CTTGGCAAGACAAATGATCG. Internal right primer: CTGGACGGGTCAGTTTCAAT. Internal WT amplicon: 2766 bp. Deletion size: 1271 bp. Deletion left flank: GCATTTGGTCTCAATGAAAAAAAGAATCAG. Deletion right flank: TTAATTAGTACCACATTTAGGATGCAAAAA. Insertion Sequence: AAAAAGAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2184 C. elegans +/mT1 II; rpb-2(ok2893)/mT1 [dpy-10(e128)] III. Show Description
C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2194 C. elegans tub-2(ok2883) I. Show Description
Y71G12A.3. External left primer: AGGCGACTTCTCTCCCTCTC. External right primer: TCATCATTATCGCCGATTCA. Internal left primer: GTGTGTGTGTGTGTGTGCGT. Internal right primer: TCCTTTCCACCAACGGATTA. Internal WT amplicon: 1267 bp. Deletion size: 861 bp. Deletion left flank: CAGATGACCTTACCCGTTATAACTTTAACC. Deletion right flank: TGGATAAGCTGCCGATTCCACTCAAGGAGA. Insertion Sequence: GATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2300 C. elegans F16B12.6(gk1118) X. Show Description
F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2375 C. elegans gcy-25(gk1187) IV. Show Description
Y105C5B.2. Identified by PCR, validated by CGH. External left primer: GCCGCAATTGTATTCTCCAT. External right primer: AATTCCCTGTTCACAGCGTC. Internal left primer: TATGTAGGGAATCGCGAAGG. Internal right primer: CTCTTGCTTCGAAACCCAAT. Internal WT amplicon: 2288 bp. Deletion size: 1832 bp. Deletion left flank: TCGATTTTTTCGGGAAATGTTGCGGAGCAC. Deletion right flank: ATTCTCAAAATTAGCTCTTTCAGTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2437 C. elegans uaf-1(gk1036)/sC1 [dpy-1(s2170) let(gk597)] III. Show Description
Y92C3B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1- and lethal-marked recombination suppressor. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and gk1036 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAAAGATGGATTTTTCGCA. External right primer: AAAATTCGTGAAAATTGCCG. Internal left primer: ATTTCTCGCTTCCACGACTG. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1125 bp. Deletion size: 606 bp. Deletion left flank: ATAGATTTTTGGCAAAGAAAATGAAAATTT. Deletion right flank: GGCGTTCAATATCTTCAAGTTTCATGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2515 C. elegans ruvb-2(ok3232) IV/nT1 [qIs51] (IV;V). Show Description
T22D1.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3232 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGAATTCACGGTTTTGTCG. External right primer: ATTTTCCAGGTTGAACGCAC. Internal left primer: GGGACAGAGCGTTTCCAAT. Internal right primer: CGCTAGACAAGCTGCAGGAC. Internal WT amplicon: 1244 bp. Deletion size: 457 bp. Deletion left flank: AACGAAAAGCATTCGATATCAAGCATATGA. Deletion right flank: CGCATTGTGAGTTTTCCGACCTTTGGTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2534 C. elegans nhr-281(gk1108) X. Show Description
F16B12.8, C24A1.3. External left primer: GCGTCCACAAAAGTGTCAGA. External right primer: GGTTTGAGAATTGCCGGATA. Internal left primer: CAACACCGTGGCATTTAGTG. Internal right primer: CCTTCACTGCACGCTAAACA. Internal WT amplicon: 1959 bp. Deletion size: 1071 bp. Deletion left flank: ACGAGGCTCAGATTGTTTATGAAATCAAAA. Deletion right flank: AAATAAAATGTGTTCTTTGGAGACAGAATA. Insertion Sequence: TTATAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2536 C. elegans W02B12.11(ok3260) II. Show Description
W02B12.11. External left primer: AAAAGACCGGACAACCACTG. External right primer: AACCTACATCAACTTCGGCG. Internal left primer: CAGCCGGATTTCTTTTCTGA. Internal right primer: CCGTTTCCTCTTCACATGCT. Internal WT amplicon: 1242 bp. Deletion size: 481 bp. Deletion left flank: ATTTACAGCCGGATTTCTTTTCTGATCCCC. Deletion right flank: CAGCGCCGAAGAGGACGGATCTTGTCCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2666 C. elegans ceh-6(ok3388) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2676 C. elegans M01B12.5(gk1101) I. Show Description
M01B12.5. External left primer: CGCCAATCCTGGTTTAAATG. External right primer: AGAACCTCTTTTGCGGGTTT. Internal left primer: ATTCCCACGCAAATAAATGG. Internal right primer: TCGAGCTGATCGTGCTACTG. Internal WT amplicon: 2467 bp. Deletion size: 575 bp. Deletion left flank: GGGAATAAATTCAATTTTTTTTCATTTTTT. Deletion right flank: ATTTTTTAAAATAAAAATATTAAATGTTTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2736 C. elegans Y48E1B.2(ok3557)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y48E1B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3557 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCGCGTACTTCTCCAACAAT. External right primer: TCTCGCAATCGGAATCTTCT. Internal left primer: CAGCTCTCTCCACCGTCTTC. Internal right primer: ACGTTCAGGAGGTCACCAAC. Internal WT amplicon: 1169 bp. Deletion size: 674 bp. Deletion left flank: GCAAGCCTCGGGTAGATGCTTCCGGGAAGA. Deletion right flank: CAGAATCTTCTGATAGCTGGGCTCCTGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3111 C. elegans gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3146 C. elegans fln-1(gk3291) IV; cdf-1(gk3543) X. Show Description
This strain is homozygous for a deletion (gk2191) in Y66H1B.2, detectable by PCR using the following primers. External left primer: AGCGAGTCCAGTGTCGATTT. External right primer: ACGTGAAGCTGGAGAGCATT. Internal left primer: GACATCCTTAATCCGGACCC. Internal right primer: AGAACCAGGAGTCTACGCGA. Internal WT amplicon: 1864 bp. Deletion size: 1225 bp. Deletion left flank: ATGGATTAGATACTTCTCTTCTAACTTTAT. Deletion right flank: CATTTTTATTTCCTAGTGAATATTACCTTA. Insertion Sequence: TTTTCCCATATTTCAGATATTACTACAATACGCTCGGTA. Validation: gk3291 passed by CGH. Other deletion (gk3543) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC315 C. elegans +/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3279 C. elegans C01B12.2(gk3198) II. Show Description
This strain is homozygous for a deletion (gk3198) in C01B12.2, detectable by PCR using the following primers. External left primer: TCAAAAATTTGCGAAACGTG. External right primer: AGGGAGTGAGCGAGAAACAA. Internal left primer: CTACATTGGTCCGACCCCTA. Internal right primer: ATGAGCTTTGCCCTGAAAGA. Internal WT amplicon: 1379 bp. Deletion size: 941 bp. Deletion left flank: AAGTTAAGCAATTTACTCAAATTATTTCAG. Deletion right flank: TGAATTTCGCAATAAAACTTTTTGGAAATT. Insertion Sequence: ATTTTT. Validation: gk3198 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3326 C. elegans W02B12.12(gk3362) II. Show Description
Homozygous viable, carrying a deletion in W02B12.12. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3364 C. elegans F37B12.3(gk3365)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3365 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTTGCGTCAAAGTACGGT. External right primer: CCTATACACCTCTCATGCCTCC. Internal left primer: GGGTACCGTATTTTAGCGCA. Internal right primer: CCTGACGAATTGCCATCTTT. Internal WT amplicon: 2539 bp. Deletion size: 983 bp. Deletion left flank: GTGACAAGTTAAAGCGAATGGACCGAACAA. Deletion right flank: TGGAATTTAATAAAAATGTGTGGCTGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC337 C. elegans gcs-1(ok436)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok436 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3680 C. elegans T23B12.11(gk3652) V; igcm-2(gk3654) X. Show Description
Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.
VC399 C. elegans fntb-1(ok590) V/nT1 [qIs51] (IV;V). Show Description
F23B12.6. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok590 homozygotes (early larval arrest, probably L2). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807