Strain Information

Name OD3696   View On Wormbase
Species C. elegans
Genotypeplk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III.
DescriptionAnalog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.
MutagenCrispr/Cas9
Outcrossedx0
Made byPablo Lara-Gonzalez
Laboratory OD
Reference PMID: 32619481
Sign in or register an account if you want to order this strain.