Strain Information
| Name | OD3696 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | plk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III. |
| Description | Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Pablo Lara-Gonzalez |
| Laboratory | OD |
| Reference | PMID: 32619481 |
Sign in
or
register an account if you want to order this strain.