Strain Information

Name OH15227   View On Wormbase
Species C. elegans
Genotypeunc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III.
Descriptionunc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
Mutagen
Outcrossedx3
Made byEduardo Leyva-Diaz
Laboratory OH
Reference Esther Serrano-Saiz, Eduardo Leyva-Díaz, Estanislao De La Cruz and Oliver Hobert. (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
Sign in or register an account if you want to order this strain.