Strain Information
Name | OH15227 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. |
Description | unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). |
Mutagen | |
Outcrossed | x3 |
Made by | Eduardo Leyva-Diaz |
Laboratory | OH |
Reference | Esther Serrano-Saiz, Eduardo Leyva-Díaz, Estanislao De La Cruz and Oliver Hobert. (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). |
Sign in
or
register an account if you want to order this strain.