Strain Information
| Name | OH15227 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. |
| Description | unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154. |
| Mutagen | |
| Outcrossed | x3 |
| Made by | Eduardo Leyva-Diaz |
| Laboratory | OH |
| Reference | Esther Serrano-Saiz, Eduardo Leyva-Díaz, Estanislao De La Cruz and Oliver Hobert. (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). |
Sign in
or
register an account if you want to order this strain.