| OD2425 |
C. elegans |
plk-1(lt18[plk-1::sGFP]::loxp) III. Show Description
GFP inserted at the C terminus of plk-1 followed by LoxP generated by Cre-mediated excision of unc-119(+) cassette. Reference: Martino L. et al. Dev Cell. 2017 Oct. 23; 43(2):157-171.
|
|
| EU1441 |
C. elegans |
plk-1(or683) III. Show Description
Temperature sensitive embryonic lethal/sterile. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
|
|
| EGD334 |
C. elegans |
egxSi100 II; plk-1(egx3[C52V, L115G]); unc-119(ed3) III. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.
|
|
| JH2997 |
C. elegans |
plk-1(ax2002) III; mbk-2(dd5) IV. Show Description
Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
|
|
| JH3003 |
C. elegans |
plk-1(ax2008) III; mbk-2(dd5) IV. Show Description
Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
|
|
| JH3012 |
C. elegans |
plk-1(ax2002) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
|
|
| VC1343 |
C. elegans |
plk-1(ok1787) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C14B9.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1787 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCACCCTTTTTCATCGG. External right primer: GCAGATCCCATTGGCATAAT. Internal left primer: AATCGACTTCCCAACATTGC. Internal right primer: TGGGACTAAAAGGGTCGATG. Internal WT amplicon: 2510 bp. Deletion size: 1798 bp. Deletion left flank: AAGGCGGTCACCGAACCTGAAGCTCGTTAT. Deletion right flank: GCCACGGTCAATGGCAGCTGCTCGTTCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| OD3696 |
C. elegans |
plk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III. Show Description
Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.
|
|
| SA127 |
C. elegans |
unc-119(ed3) III; tjIs5. Show Description
tjIs5 [pie-1p::GFP::plk-1 + unc-119(+)]. GFP::PLK-1 is found at the mitotic centrosomes, kinetochores, and midbody in early embyros. pID3.01-plk-1. Integration site unknown. Maintain at 25C to avoid transgene silencing.
|
|
| TX773 |
C. elegans |
teIs65 II; unc-119(ed3) III; him-3(e1147) IV. Show Description
teIs65 [pie-1p::GFP::plk-1(PBD) + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs65 contains GFP fused to the PLK-1 protein-binding domain. Derived from injection of pRL1216. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97.
|
|