Strain Information

Name XMN1253   View On Wormbase
Species C. elegans
Genotypedaf-15(bgg95) IV.
DescriptionMaintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTG
ACGAGATGTATTGGTTGTATTACACAGAC.
Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
MutagenCrispr/Cas9
Outcrossedx4
Made byElyse L. Christensen and Brock Grill
Laboratory MC
Reference Sun, C.L., Xu, C., Itani, O., Christensen, E.L., Vijay, H., Ho, J., Correa-Medina, A., Klingler, C.B., Mathew, N.D., Flibotte, S., Ian R. Humphreys, Diego Delgadillo Rubalcaba, Alison E. Ritter, Muriel Desbois7, Brock Grill, C. Michael Crowder. (2025). Biased regulation of protein synthesis and hypoxic death by a conditional raptor mutation. Curr Biol 35, 2567-2582 e2565. 10.1016/j.cub.2025.04.040. Accession Number: 40339571 PMCID: PMC12151773 DOI: 10.1016/j.cub.2025.04.040
Sign in or register an account if you want to order this strain.