Strain Information

Name VC2328   View On Wormbase
Species C. elegans
GenotypegkDf19 gkDf20 II; F55C5.6(gk3058) rskd-1(gk1208) V.
DescriptionT13B5.5, T13B5.6, T13B5.7, Y53F4B.25, Y53F4B.27, F55C5.6, F55C5.7. The allele gk1208 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AACTTCGGGAATGTCAATGC. External right primer: CAATTTTGGACCAACCCAAT. Internal left primer: GCCAGAGACCTTCCACAGAG. Internal right primer: ACTTTCAATTTCCGGACGTG. Internal WT amplicon: 2542 bp. Deletion size: 1329 bp. Deletion left flank: TCCCGGTTCTACGAATTCCAGAAGTAATAT. Deletion right flank: CTTCAGCTCTTTGAGCCGTTGCCACTAGCT. The allele gkDf19 was identified by CGH but not confirmed by PCR. Left flanking probe: AATGTGGAAAAGGGCTACTCGCTTGTCTATGCTGAAACGTAGGTTGTGAA. Right flanking probe: CACTTCATCTCAAGATTTCGTTGAGAAGTGTCGGTTGTATTGCCCCATGT. Left deleted probe: GATCTGGCAAAATGTTGTTGAAAACTTAAATTTTTCCACCAAGTTTTTGT. Right deleted probe: AATTGGGGATCCTTCTCCATGTGCCACAATATCAACCTGATTATTCGTAA. The allele gkDf20 was identified by CGH but not confirmed by PCR. Left flanking probe: ATGCTGTGAACGTGCTGGAATTCTATCGTTCCAAGGCGGAAAATGTATTC. Right flanking probe: GAAACTATGCGATTCGAGTGGAGAATAAGAAAAAGTCATCGTTGATTTCT. Left deleted probe: ATGTATTCCATTCTGTCGAACCCACGTGGCAACTCCTTCAAATGTTTTCG. Right deleted probe: TGGGAAAAGCCGGCCACCGCCATCTGGAAACTATGCGATTCGAGTGGAGA. The allele gk3058 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAAACCACTCTGGAAGACGATTTCATGGTTTTCGAGCCCAGTTCATGG. Right flanking probe: AATTCACTGTTTACCACTCTGTGAACCTGGATGTGTCAAGGGGTGCGACC. Left deleted probe: TGTTTATATTCCTGGAAACAGCATATAACCTTCTCTGTAGATTCAACGAT. Right deleted probe: AGTGTACAAGTGGCAGGTCACAACAGTATACTCTACGTACCAACTTCCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MutagenUV/TMP
Outcrossedx0
Made byVancouver KO Group
Laboratory VC
Sign in or register an account if you want to order this strain.