Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
ESC716 C. elegans ida-1(cse716[ida-1:: wrmScarlet]) III. Show Description
mScarlet tag inserted into the C-terminus of the endogenous ida-1 locus. Maintain at 16-20C. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
GLW53 C. elegans egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
GLW65 C. elegans sod-2(utx53[mScarlet::3xMyc::sod-2]) I. Show Description
N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3’ (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64.
GLW79 C. elegans sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. Show Description
N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.
GLW85 C. elegans pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. Show Description
N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.
GLW89 C. elegans ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. Show Description
N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.
GLW91 C. elegans hrpa-1(utx71[hrpa-1::mScarlet-I-C1::3xMyc]) IV. Show Description
C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.
GLW93 C. elegans clic-1(utx73[mScarlet-I-C1::3xMyc::clic-1]) V. Show Description
N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.
GT330 C. elegans aSi8 II; unc-119(ed3) III. Show Description
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT332 C. elegans aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR] II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT337 C. elegans aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST] II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT347 C. elegans aSi23 II; unc-119(ed3) III. Show Description
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT350 C. elegans aSi26 II; unc-119(ed3) III. Show Description
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT372 C. elegans aSi31 II; unc-119(ed3) III Show Description
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT375 C. elegans aSi27 II; unc-119(ed3) III. Show Description
aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT377 C. elegans aSi36 II; unc-119(ed3) III. Show Description
aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
JAR50 C. elegans rack-1(rns8[rack-1::mScarlet]] IV. Show Description
mScarlet tag inserted into endogenous rack-1 locus. Ubiquitous mScarlet expression.
JAZ454 C. elegans jlgEx220. Show Description
jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
JAZ515 C. elegans nep-2(ok2846) II; jlgEx251. Show Description
jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
JDW101 C. elegans spe-44(wrd20[spe-44::mScarlet::3xMyc]) IV. Show Description
mScarlet::3xMyc tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Allele obtained using the self-excising cassette, following Dickinson et al, 2015 method. SEC was excised; there is a lox511I in the synthetic intron left by the excision. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
JDW120 C. elegans spe-44(wrd32[spe-44::mScarlet::TEV::AID*::3xFLAG]) IV. Show Description
mScarlet::TEV::AID*::3xFLAG tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Insertion includes a flexible 30 amino acid linker between SPE-44 and mScarlet and was produced by SEC excision. Strain contains a lox511I site in a synthetic intron. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
JDW684 C. elegans nhr-23(wrd33[nhr-23::30aa linker::mScarlet::SEC::3XMyc]) I. Show Description
mScarlet::3xMyc tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. A flexible 30 amino acid linker is between the nhr-23 coding sequence and mScarlet. Allele obtained using the self-excising casstte, following Dickinson et al, 2015 method. Reference: Myles KM, et al. MicroPubl Biol. Oct 2:2023:10.17912/micropub.biology.000996. doi: 10.17912/micropub.biology.000996. eCollection 2023. PMID: 37854098.
JDW708 C. elegans nas-37(wrd106 wrd251[nas-37::mScarlet::2xOLLAS]) X. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous nas-37 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd106.
JDW778 C. elegans K10D3.4(wrd296 wrd310[K10D3.4::mScarlet::2xOLLAS]) I. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous K10D3.4 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd296.
JDW780 C. elegans col-125(wrd300 wrd312[col-125::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.
JDW781 C. elegans col-103(wrd301 wrd313[col-103::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-103 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd301.
JDW782 C. elegans piit-1(wrd302 wrd314[piit-1::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous piit-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd302.
JDW783 C. elegans ctsa-1.1(wrd303 wrd315[ctsa-1.1::mScarlet::2xOLLAS]) II. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous ctsa-1.1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd303.
JDW785 C. elegans lon-8(wrd305 wrd317[lon-8::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous lon-8 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd305.
JDW794 C. elegans dpy-14(wrd229 wrd325[dpy-14::mScarlet::2xOLLAS) I. Show Description
mScarlet::2xOLLAS tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Generated by replacing mNG::3xFLAG with mScarlet::2xOLLAS in parental strain JDW651.
JDW818 C. elegans dpy-13(syb3318(wrd337[dpy-13::30x linker::mScarlet(dpi)::10x linker]) IV. Show Description
30x linker::mScarlet(dpi)::10x linker tag inserted into the C-terminus of the endogenous dpy-13 locus by CRISPR using a Cas9 RNP. Derived by modification of syb3318[dpy-13::mNG] in parental strain PHX3318, replacing mNeonGreen with the mScarlet and linkers.
JDW894 C. elegans cpz-1(wrd128 wrd379[cpz-1::internal mScarlet::2xOLLAS]) I. Show Description
Superficially wild type. Linker::mScarlet::2xOLLAS::linker inserted internally, to produce a translational fusion 11 amino away from the C-terminus of the endogenous cpz-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd128.
JH3904 C. elegans tdp-1(ax4546[tdp-1::wrmScarlet]) II. Show Description
wrmScarlet is inserted at the C-terminus of the endogenous tdp-1 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3906 C. elegans ran-2(ax4545[ran-2::wrmScarlet]) III. Show Description
wrmScarlet is inserted at the C-terminus of the endogenous ran-2 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4201 C. elegans npp-11(ax4547[npp-11::wrmScarlet]) I. Show Description
wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4202 C. elegans npp-22(ax4549[npp-22::wrmScarlet]) V. Show Description
wrmScarlet is inserted at the C-terminus of the endogenous npp-22 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4476 C. elegans nucl-1(syb8070[nucl-1::wrmScarlet]) IV. Show Description
wrmScarlet tag inserted at C-terminus of endogenous nucl-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH4816 C. elegans car-1(syb8217[car-1::wrmScarlet] I. Show Description
wrmScarlet tag inserted at C-terminus of endogenous car-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JWW253 C. elegans wrdSi3 II; ifet-1(dfw16[ifet-1::mScarlet-I::AID*::3xFlag]) III. Show Description
mScarlet-I::AID*::3xFlag tags inserted at the C-terminus of the endogenous ifet-1 locus. wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. ifet-1 visualized by mScarlet in oocytes with inducible acute degradation when grown on 4mM auxin. No defect in hermaphrodite embryo viability. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
KRA867 C. elegans tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I; lat-1(syb8408[lat-1(before 651 aa)aaaaA::EGFP::linker::3xFLAG::aaaaA]) II. Show Description
syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
LP896 C. elegans unc-94(cp439[unc-94::mNG-C1]) I; cap-1(cp436[mScarlet-I-C1::cap-1]) IV. Show Description
mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
MLC1480 C. elegans lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MSB555 C elegans twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Show Description
wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MSB861 C. elegans mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
NK2949 C. elegans qySi205 I. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion. Anchor cell specific expression of prenylation enzyme icmt-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2966 C. elegans qySi205 I; unc-6(ev400) X. Show Description
qySi205 [lin-29p::icmt-1::mScarlet] I. unc-6 mutant expressing anchor cell specific prenylation enzyme icmt-1. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2990 C. elegans qySi205; qyIs562. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3065 C. elegans qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
OD4376 C. elegans mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. Show Description
CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.
OH19124 C elegans pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.