More Fields
Strain Species Genotype
CYA1 C. elegans rexIs1. Show Description
rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CYA19 C. elegans dvIs19 III; rexEx11. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.
DG3913 C. elegans strain/search?st1=lin-41&sf1=all">lin-41(strain/search?st1=tn1541&sf1=all">tn1541[strain/search?st1=GFP&sf1=all">GFP::strain/search?st1=tev&sf1=all">tev::s::strain/search?st1=lin-41&sf1=all">lin-41]) I. Show Description
lin-41(tn1541[GFP::tev::s::lin-41]) I. May be maintained under normal conditions.
DG3922 C. elegans strain/search?st1=tiar-1&sf1=all">tiar-1(strain/search?st1=tn1545&sf1=all">tn1545[strain/search?st1=tiar-1&sf1=all">tiar-1::s::tev::GFP]) II. Show Description
tiar-1(tn1545[tiar-1::s::tev::GFP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr; 6(4): 1031-1047.
DG4569 C. elegans cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051. doi: 10.1093/genetics/iyac051. PMID: 35377419
DZ840 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
FGP3 C. elegans unc-119(ed3) III; fgpIs23. Show Description
fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FGP4 C. elegans unc-119(ed3) III; fgpIs24. Show Description
fgpIs24 [(pFGP77) pie-1p::GFP::TEV-S-Tag::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. When compared with strain FGP3, the difference in fluorescence signal corresponds to SUMO conjugation in FGP3. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
GW1419 C. elegans met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 locus, with MET-2::mCherry signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1618 C. elegans lin-65(gw1578[lin-65::FLAG::TEV::GFP]) I. Show Description
Superficially wild-type. Endogenously tagged lin-65 locus, with LIN-65::GFP signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1621 C. elegans lin-65(gw1578[lin-65::FLAG::TEV::GFP]) I; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and lin-65 loci. MET-2::mCherry and LIN-65::GFP signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1623 C. elegans arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
JDW92 C. elegans wrdSi19 nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; him-5(e1490) V. Show Description
wrdSi19 [mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3'UTR] (I:-5.32). Strain allows germline-specific depletion of NHR-23::AID*LLTEV::3xFLAG using the auxin-inducible degron system. wrdSi19 was made by crossing parental strain KRY87 to JDW83 [wrdSi10 (mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3?UTR+SEC, I:-5.32); him5(e1490) V] and using heatshock to remove the SEC. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
JH2549 C. elegans unc-119(ed3) III; axIs1957. Show Description
axIs1957 [pie-1p::Dendra2::TEV::S-peptide::mex-5::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2550 C. elegans unc-119(ed3) III; axIs1962. Show Description
axIs1962 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2553 C. elegans unc-119(ed3) III; axIs1958. Show Description
axIs1958 [pie-1p::Dendra2::TEV::S-peptide::mex-5(aa345-aa468)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2560 C. elegans unc-119(ed3) III; axIs1959. Show Description
axIs1959 [pie-1p::Dendra2::TEV::S-peptide::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2593 C. elegans unc-119(ed3) III; axIs1961. Show Description
axIs1961 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2607 C. elegans unc-119(ed3) III; axIs1963. Show Description
axIs1963 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2636 C. elegans unc-119(ed3) III; axIs1960. Show Description
axIs1960 [pie-1p::Dendra2::TEV::S-peptide::mex-5(C286S C292S C331S C337S)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2800 C. elegans unc-119(ed3) III; axIs1964. Show Description
axIs1964 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2801 C. elegans unc-119(ed3) III; axIs1965. Show Description
axIs1965 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2802 C. elegans unc-119(ed3) III; axIs1950. Show Description
axIs1950 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2804 C. elegans unc-119(ed3) III; axIs1951. Show Description
axIs1951 [pie-1p::Dendra2::TEV::S-peptide::mex-5RR(S404A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2889 C. elegans unc-119(ed3) III; axIs1955. Show Description
axIs1955 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(S458A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2890 C. elegans unc-119(ed3) III; axIs1956. Show Description
axIs1956 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(R274E K318E)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH4008 C. elegans htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
KRY84 C. elegans nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-25 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
KRY85 C. elegans ieSi57 II; nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
KRY87 C. elegans nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I. Show Description
AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
KRY88 C. elegans nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
LE3845 C. elegans rdvIs1 III; egl-20(gk453010) IV; lqIs58 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.
LE3992 C. elegans rdvIs1 III; lqIs80 IV. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.
OD10 C. elegans unc-119(ed3) III; ltIs6. Show Description
ltIs6 [pIC35; pie-1p::kbp-5::GFP-TEV-STag + unc-119(+)].
OD11 C. elegans unc-119(ed3) III; ltIs7. Show Description
ltIs7 [(pIC41) pie-1p::kbp-4::GFP::TEV-STag + unc-119(+)]. [NOTE: Array might be prone to silencing; rescue of unc-119 appears incomplete.]
OD13 C. elegans unc-119(ed3) III; ltIs9. Show Description
ltIs9 [pie-1p::kbp-3::GFP::TEV-S Tag + unc-119(+)].
OD142 C. elegans unc-119(ed3) III; ltIs78. Show Description
ltIs78 [(pKO5) pie-1::GFP::TEV::Stag::air-1 spliced coding + unc-119(+)].
OD27 C. elegans unc-119(ed3) III; ltIs14. Show Description
ltIs14 [(pASM05) pie-1p::GFP-TEV-STag::air-2 + unc-119(+)].
OD2906 C. elegans mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2909 C. elegans san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. Show Description
GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac
OD31 C. elegans unc-119(ed3) III; ltIs22. Show Description
ltIs22[pPM3; pie-1::GFP-TEV-STag::KNL-2 + unc-119(+)].
OD4087 C. elegans cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4376 C. elegans mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. Show Description
CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.
OD61 C. elegans unc-119(ed3) III; ltIs41. Show Description
ltIs41[pAA5; pie-1::GFP-TEV-STag::CAR-1; unc-119(+)].
OD62 C. elegans unc-119(ed3) III; ltIs42. Show Description
ltIs42[pAA19; pie-1::GFP-TEV-Stag::CAR-1deltaN; unc-119(+)].
OD63 C. elegans unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain.
OD7 C. elegans unc-119(ed3) III; ltIs3. Show Description
ltIs3[pIC31; pie-1 promoter::hcp-1::GFP-TEV-STag + unc-119(+)].
OD76 C. elegans unc-119(ed3) III; ltIs75. Show Description
ltIs75 [(pSK5) pie-1::GFP::TEV-STag::LacI + unc-119(+)].