More Fields
Strain Species Genotype
NL706 C. elegans mut-2(r459) cap-1(pk56::Tc1) I. Show Description
HZ504 C. elegans him-5(e1490) V; bpIs37. Show Description
bpIs37 [dcap-1p::dcap-1::DsRed + rol-6(su1006)]. Rollers. Translational DsRed reporter for the P body-specific marker dcap-1, which encodes the C. elegans ortholog of decapping complex component DCAP1. Low levels of expression are homogenously distributed in the cytoplasm at all stages of embryogenesis. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
HZ769 C. elegans him-5(e1490) V; bpIs88. Show Description
bpIs88 [tia-1p::tia-1::GFP + dcap-1p::dcap-1::RFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
RG3256 C. elegans cap-1(ve756[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve756 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tggagaggattaggaagatgatgaagacca ; Right flanking sequence: tacttgagatatttagtttgaaatgttttt. sgRNA #1: tttgcttcaagttcgtctgc; sgRNA #2: atctctatccactttccgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC1640 C. elegans dcap-1&Y55F3AM.13(ok2139) IV. Show Description
Y55F3AM.13, Y55F3AM.12. External left primer: AAATCAGGGAAATATCGGGG. External right primer: TTTTCCAGGGTAAATCACGC. Internal left primer: GTCGTCGGTTTGCATTAGGT. Internal right primer: ACGTGGGAGACCAATCTGAC. Internal WT amplicon: 2730 bp. Deletion size: 1252 bp. Deletion left flank: AGCTTCTGGAGCATTGGCGGCATTTGTTCG. Deletion right flank: TTCCTACTTTTCCCAGCCAAATCGCTTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807