| KR523 |
C. elegans |
nhr-23(h209) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the Dup are Unc. Animals which have lost the Dup are DpyUncLet. Lethal mid-larval.
|
|
| JDW29 |
C. elegans |
nhr-23(wrd8[nhr-23::GFP::AID*::3xFLAG]) I. Show Description
GFP::AID*::3xFLAG tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. Allele obtained using the self-excising casstte, following Dickinson et al, 2015 method. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
|
|
| JDW684 |
C. elegans |
nhr-23(wrd33[nhr-23::30aa linker::mScarlet::SEC::3XMyc]) I. Show Description
mScarlet::3xMyc tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. A flexible 30 amino acid linker is between the nhr-23 coding sequence and mScarlet. Allele obtained using the self-excising casstte, following Dickinson et al, 2015 method. Reference: Myles KM, et al. MicroPubl Biol. Oct 2:2023:10.17912/micropub.biology.000996. doi: 10.17912/micropub.biology.000996. eCollection 2023. PMID: 37854098.
|
|
| JDW92 |
C. elegans |
wrdSi19 nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; him-5(e1490) V. Show Description
wrdSi19 [mex-5p::TIR1:F2A:mTagBFP2:AID*::NLS::tbb-2 3'UTR] (I:-5.32). Strain allows germline-specific depletion of NHR-23::AID*LLTEV::3xFLAG using the auxin-inducible degron system. wrdSi19 was made by crossing parental strain KRY87 to JDW83 [wrdSi10 (mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3′UTR+SEC, I:-5.32); him5(e1490) V] and using heatshock to remove the SEC. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
|
|
| KRY87 |
C. elegans |
nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I. Show Description
AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| KRY88 |
C. elegans |
nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| OP43 |
C. elegans |
unc-119(ed3) III; wgIs43. Show Description
wgIs43 [nhr-23::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| RW10429 |
C. elegans |
unc-119(ed3) III; gaIs269. Show Description
gaIs269 [nhr-23::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in fosmid P000006_G11.
|
|
| OP228 |
C. elegans |
unc-119(ed3) III; wgIs228. Show Description
wgIs228 [nhr-237::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP489 |
C. elegans |
unc-119(tm4063) III; wgIs489. Show Description
wgIs489 [nhr-232::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| RB1931 |
C. elegans |
feh-1&nhr-239(ok2526) III. Show Description
Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1661 |
C. elegans |
nhr-230(gk814) V. Show Description
Y17D7A.1. External left primer: GCCCGCACTGTGTAATTTTT. External right primer: ATTTTGCGTGTTGTCGATGA. Internal left primer: GGTCGAACCTGCGACATACT. Internal right primer: TGGGACAATTTGGGACATTT. Internal WT amplicon: 2267 bp. Deletion size: 1916 bp. Deletion left flank: TTTGTTTTGAACTAGAATTTGCAAATTCTG. Deletion right flank: AAAACTCAAACTTCGAAAACCTGGACAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1724 |
C. elegans |
nhr-238(gk833) V. Show Description
Y46H3D.7. External left primer: TCTCCGGTCCTTGAAAACTG. External right primer: ATACAAGCCGGGTATTGACG. Internal left primer: GCTCACCGAAATCCCAATAA. Internal right primer: TTGCATGACCAGCAGGAATA. Internal WT amplicon: 1813 bp. Deletion size: 805 bp. Deletion left flank: AAAAATTTCAAAATATTAAGTTTTTAACGT. Deletion right flank: GTAGTTAAAAATTGGCAAACATAGATGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1806 |
C. elegans |
nhr-234(gk865) II. Show Description
Y38E10A.18. External left primer: TTACATTGCCTCTGTCTGCG. External right primer: TGGTTTCGAGGAAGTTTTGG. Internal left primer: CAAGGTTCGCGTCTTGAAGT. Internal right primer: ACACCAGCAAATCATCATGC. Internal WT amplicon: 1932 bp. Deletion size: 781 bp. Deletion left flank: CACCCACCCCTGATTGAAATGTCCATTGTC. Deletion right flank: AAAAGGCACCCTCCACTTCGGATCCGTCGT. Insertion Sequence: GGGGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1845 |
C. elegans |
nhr-230(gk898) V. Show Description
Y17D7A.1. External left primer: TTTCCTACGTCACACACCCA. External right primer: AAAAATTACACAGTGCGGGC. Internal left primer: GCATCCAAGCTTCTTCCAAC. Internal right primer: TAGTGCTAATCGGGTCCCTG. Internal WT amplicon: 2252 bp. Deletion size: 1576 bp. Deletion left flank: ATTTGTGCTGTGTGCTCACAGCCGGCACGT. Deletion right flank: ACTAAGCTCACAAATGTCCCAAACGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2086 |
C. elegans |
nhr-237(gk1050) V. Show Description
Y46H3D.6. External left primer: TCGAATTGCATTTTGACAGC. External right primer: CGAAAAACAAGCAGCACAAA. Internal left primer: ACACGAATGCATAATTGCCA. Internal right primer: TACCGCCCAGTTTCAAGTTC. Internal WT amplicon: 2013 bp. Deletion size: 1085 bp. Deletion left flank: TCTGGGCTTCACTGATTGGGGTTAACGATT. Deletion right flank: CTTTATTAGACTCAAAGTTGTCTGAAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2317 |
C. elegans |
nhr-235(gk1085) II. Show Description
Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3872 |
C. elegans |
nhr-239(gk3837[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAATTTGAATAAAAATTGGCCGCGCTA; Right flanking sequence: TGGATGCAGTTGCTTTTTCAAGAGAAGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC437 |
C. elegans |
nhr-233(gk223) V. Show Description
Y32B12B.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC551 |
C. elegans |
nhr-233(ok770) V. Show Description
Y32B12B.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|