Search Strains

Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.

uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Maintain at 15C. Give about 50% dead embryos at 15C. Gives 100% dead embryos at 20C and 25C.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.

Heterozygotes are WT and segregate WT, Lon males, and dead eggs. sdc-2(y74)/sdc-2(y74) is lethal, although about 3% of the animals escape the lethality. These animals are extremely Dpy, extensively masculinized, and never fertile.

Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.

vps-34 [Y752C] #2. StyI restriction site created by synonymous changes, ease for genotyping. vps-34 [Y752C] are wild-type for the following phenotypes: Length, Width, Body wavelength, Crawl speed, Thrash rate, Pharyngeal Pump frequency, duration, R/E ratio, Germ cell corpse engulfment, coelomocyte endocytosis, coelomocyte size, gut vesicle size, and RAB-7(+) gut vesicle size.

jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).

Isolated from the soil in a kabocha pumpkin patch garden (Baermann funnel method) in Kurtistown (native Hawaiian place name: Ola'a), Hawaii Island, on June 24, 2008.

leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.

leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.

Temperature sensitive missense allele. Larval lethal and Vul at 25C. About WT at 20C. Previously called let-341.

Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.

vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

ok1749. Homozygous sterile deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1749 homozygotes (sterile Unc adult, often with mid-body constriction). Homozygous hT2[qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTTTTGTACGTCGATTT. External right primer: TCGGATCCTACTCGCTCATT. Internal left primer: AATCGCTCCCAACAGAATTG. Internal right primer: TTATTTCAGTTCCCGGATCG. Internal WT amplicon: 2960 bp. Deletion size: 1234 bp. Deletion left flank: TTTCTCAACTTTCGGACGACGTCCGAACGG. Deletion right flank: GGAAATTGATACGTTATTTTTAAGAATGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk965), it is homozygous for 546 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Wild type N2, subculture of VC196. This strain was subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

This strain is homozygous for a deletion (gk1058) in K12H6.12, detectable by PCR using the following primers. External left primer: CTGCGTCTCTCACTTTTCCC. External right primer: CTTCGTTGCAGACACTTGGA. Internal left primer: GGAGGAGAACAATGGCTCAA. Internal right primer: AGCTGAGTAACGGCGATTTG. Internal WT amplicon: 2398 bp. Deletion size: 1627 bp. Note: Internal right primer binding site deleted in gk1058. Deletion product from nested PCR runs at about 1150 bp. Deletion left flank: AATTATAATCATGTGGCGAAGCACATGAAA. Deletion right flank: AAATCAATATTTTCCATTGTTCTTGATGCT. Insertion Sequence: CTTTGAAAATATTTGAATTTAGCGGGAAATTCAAAATTTTTTGAGAAAAAGCTTTGGCG GGATTTTCAAAATCTTTGAAAAAAAAACACATTTCGGCGGGAATTTCAAATTTCCTGAC AAAGCTCTTCGGCGGTAAAATACCATTTTTTTCAGAAAATTTTCGATTAAAGAATTAGG ATTAAATTTTTTAAGAAAAAAAAGCAGT. Validation: PCR, CGH diagnostics for gk1058 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Unc-22 twitcher. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3072), it is homozygous for 65 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2406), it is homozygous for 206 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2608gk2609), it is homozygous for 224 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.7, F59G1.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok610 homozygotes (viable GFP- adult, sometimes slow-growing with various occasional body defects). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: GFP+ animals also have GFP expression in body wall.] Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. [NOTE: a user has reported that gk5787 homozygotes are viable but extremely slow growing, taking about 5 to 7 days to reach adulthood.] Deletion of 3433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGCCTATCAGTCTATAGTTTTCATTATCCA. Right flanking sequence: AATGTTTTTGTCACGAAAGTTAAATAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

B0379.4a. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk283 homozygotes (slow-growing with small broods, dark-bodied, sometimes sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53B6.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok881 homozygotes (larval arrest, lumpy body). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42A6.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok963 homozygotes (slow-growing with body morphology defects, small broods). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0334.11a. Homozygous subviable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1134 homozygotes (variable phenotypes, including Gro, Dpy, Unc, Clr, some embryonic lethality, various other body morphology defects; population cannot be maintained at 20 degrees - other temperatures not tested). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B9.4a. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1066 homozygotes (viable lethargic Unc, various body morphology defects, often grotty, does not starve plate easily). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24A8.6. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and gk413 homozygotes (sick, often sterile, with body morphology defects, lots of arrested embryos). Also segregates viable gk413 hemizygotes (WT males). Phenotype of homozygote may be suspicious, as deletion appears to affect only an intron. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F3.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

vkIs2881 [nhx-2p::glo-1::CemOrange2 + ges-1p::glo-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and GLO-1::GFP under the Pnhx-2 and Pges-1 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas

vkIs2882 [nhx-2p::glo-1::CemOrange2 + vha-6p::lmp-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and LMP-1::GFP under the Pnhx-2 and Pvha-6 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas

vkEx3160 [nhx-2p::abt-4::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

vkEx3161 [nhx-2p::abt-4(L162P)::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4(L162P)::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

Nicotine-gated current reduced in body wall muscle cells. Disrupted localization of ACR-16 in body wall muscle cells.

B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.

zpEx99 [pat-6::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx99 produces a fully functional GFP-tagged pat-6 protein that localizes to the dense bodies in muscle cells. Rescues the lethal phenotype of pat-6(st561) homozygous animals. Reference: Lin X, et al. Curr Biol. 2003 May 27;13(11):922-32.

zpEx204 [pat-4::YFP + pat-3::CFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx204 produces a fully functional YFP-tagged pat-4 protein that localizes to the dense bodies in muscle cells, and rescues the lethal phenotype of pat-4(st551) homozygous animals. Reference: Mackinnon AC, et al. Curr Biol. 2002 May 14;12(10):787-97.

wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

3xFlag tag inserted at N-temrinus of endogenous rpl-22 locus. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments.