Search Strains

vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

ok1749. Homozygous sterile deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1749 homozygotes (sterile Unc adult, often with mid-body constriction). Homozygous hT2[qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTTTTGTACGTCGATTT. External right primer: TCGGATCCTACTCGCTCATT. Internal left primer: AATCGCTCCCAACAGAATTG. Internal right primer: TTATTTCAGTTCCCGGATCG. Internal WT amplicon: 2960 bp. Deletion size: 1234 bp. Deletion left flank: TTTCTCAACTTTCGGACGACGTCCGAACGG. Deletion right flank: GGAAATTGATACGTTATTTTTAAGAATGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK856.9, ZK856.13. mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs10 homozygotes), and non-GFP sterile Uncs with a vulval blip (gk144 homozygotes). mIs10 suppresses recombination from unc-60 to about dpy-11 on LG V, and does not balance gk144 perfectly, but this strain is not difficult to keep. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk965), it is homozygous for 546 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Wild type N2, subculture of VC196. This strain was subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

This strain is homozygous for a deletion (gk1058) in K12H6.12, detectable by PCR using the following primers. External left primer: CTGCGTCTCTCACTTTTCCC. External right primer: CTTCGTTGCAGACACTTGGA. Internal left primer: GGAGGAGAACAATGGCTCAA. Internal right primer: AGCTGAGTAACGGCGATTTG. Internal WT amplicon: 2398 bp. Deletion size: 1627 bp. Note: Internal right primer binding site deleted in gk1058. Deletion product from nested PCR runs at about 1150 bp. Deletion left flank: AATTATAATCATGTGGCGAAGCACATGAAA. Deletion right flank: AAATCAATATTTTCCATTGTTCTTGATGCT. Insertion Sequence: CTTTGAAAATATTTGAATTTAGCGGGAAATTCAAAATTTTTTGAGAAAAAGCTTTGGCG GGATTTTCAAAATCTTTGAAAAAAAAACACATTTCGGCGGGAATTTCAAATTTCCTGAC AAAGCTCTTCGGCGGTAAAATACCATTTTTTTCAGAAAATTTTCGATTAAAGAATTAGG ATTAAATTTTTTAAGAAAAAAAAGCAGT. Validation: PCR, CGH diagnostics for gk1058 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Unc-22 twitcher. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3072), it is homozygous for 65 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2406), it is homozygous for 206 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2608gk2609), it is homozygous for 224 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.7, F59G1.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok610 homozygotes (viable GFP- adult, sometimes slow-growing with various occasional body defects). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: GFP+ animals also have GFP expression in body wall.] Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. [NOTE: a user has reported that gk5787 homozygotes are viable but extremely slow growing, taking about 5 to 7 days to reach adulthood.] Deletion of 3433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGCCTATCAGTCTATAGTTTTCATTATCCA. Right flanking sequence: AATGTTTTTGTCACGAAAGTTAAATAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

B0379.4a. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk283 homozygotes (slow-growing with small broods, dark-bodied, sometimes sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53B6.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok881 homozygotes (larval arrest, lumpy body). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42A6.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok963 homozygotes (slow-growing with body morphology defects, small broods). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0334.11a. Homozygous subviable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1134 homozygotes (variable phenotypes, including Gro, Dpy, Unc, Clr, some embryonic lethality, various other body morphology defects; population cannot be maintained at 20 degrees - other temperatures not tested). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B9.4a. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1066 homozygotes (viable lethargic Unc, various body morphology defects, often grotty, does not starve plate easily). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24A8.6. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and gk413 homozygotes (sick, often sterile, with body morphology defects, lots of arrested embryos). Also segregates viable gk413 hemizygotes (WT males). Phenotype of homozygote may be suspicious, as deletion appears to affect only an intron. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F3.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

vkIs2881 [nhx-2p::glo-1::CemOrange2 + ges-1p::glo-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and GLO-1::GFP under the Pnhx-2 and Pges-1 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas

vkIs2882 [nhx-2p::glo-1::CemOrange2 + vha-6p::lmp-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and LMP-1::GFP under the Pnhx-2 and Pvha-6 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas

vkEx3160 [nhx-2p::abt-4::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

vkEx3161 [nhx-2p::abt-4(L162P)::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4(L162P)::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

Nicotine-gated current reduced in body wall muscle cells. Disrupted localization of ACR-16 in body wall muscle cells.

B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.

zpEx99 [pat-6::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx99 produces a fully functional GFP-tagged pat-6 protein that localizes to the dense bodies in muscle cells. Rescues the lethal phenotype of pat-6(st561) homozygous animals. Reference: Lin X, et al. Curr Biol. 2003 May 27;13(11):922-32.

zpEx204 [pat-4::YFP + pat-3::CFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx204 produces a fully functional YFP-tagged pat-4 protein that localizes to the dense bodies in muscle cells, and rescues the lethal phenotype of pat-4(st551) homozygous animals. Reference: Mackinnon AC, et al. Curr Biol. 2002 May 14;12(10):787-97.

wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

3xFlag tag inserted at N-temrinus of endogenous rpl-22 locus. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments.

wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.

ojIs34 [GFP::car-1 + unc-119(+)]. N'-tagged GFP::CAR-1 (Y18D10A.17) fusion. Labels P-granules and small cytoplasmic puncta in all cells. Bombardment with pNL1.6::GFP::unc-119 (pfj-1::pie-1 promoter driving GFP::Y18D10A.17 (N-terminal) with unc-119 rescuing fragment).

3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.

Nuclear body wall muscle GFP+.

srf780 is a deletion of the Smr nuclease domain of nonu-1. Unc. GFP expression in body wall muscle. Reference: Glover ML, et al. Cell Rep. 2020 Mar 31;30(13):4321-4331.e4. doi: 10.1016/j.celrep.2020.03.023. PMID: 32234470.

sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.

Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12.

Slow growing at 20C. About 50% larval lethality at 15C. Maintain at 20C.

qaIs1400 [hsp16-2::ptx + unc-36(+)]. ptx is the gene for pertussis toxin S1 subunit from Bordetella pertussis.

Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).

qaEx6401 [hlh-17::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression in sheath cells of cephalic sensilia. Transmission frequency is about 38%.

Heterozygotes are Egl and Paralyzed. Segregate embryonic lethals (n499) homozygotes. Segregates WT animals that lay only non-refractile eggs that fail to hatch. Pick paralyzed Egl worms to maintain (eggs on the plate should all be pale brown and non-refractile; presence of refractile eggs indicates a recombination has occurred). XA780 recombines at a frequency of about 1%.