Search Strains

gaIs285 [unc-62(7a)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which was outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1888.

gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1894.

gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Reduced autofluorescence. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Temperature-sensitive sterile. Maintain at 15C. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

8xMS2 tag inserted at C-terminus of endogenous C42D4.3 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.

8xMS2 tag inserted at C-terminus of endogenous mai-1 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.

zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.

zcIs14 [myo-3::GFP(mit)]. Stable transgenic line expressing GFP at high levels in mitochondria of body wall muscle. Slight developmental delay and reduced brood size observed.

Hets are WT and segregate WT, Dpy and males of both kinds.

Temperature-sensitive. Maintain at 15C. The embryos from homozygous mutant mothers display defects in the unequal cell divisions of P2 and P3, defects in partitioning of germ granules during these divisions, and defects in formation of the germ-line precursor cell P4. The embryos that lack P4 develop into sterile adults. These defects are incompletely expressed and sensitive to temperature. Homozygous mothers produce about 10% sterile progeny at 16C and 70% sterile progeny at 25C. The temperature-sensitive period is early in embryogenesis, from fertilization to about the 28-cell stage. See also WBPaper00002282.

Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%. Throws males.

Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.

Temperature sensitive sterility. The sterility has both a maternal and a non-maternal component. Can be maintained indefinitely at low temperatures (16-23 C), with 7-19% sterile offspring. When low-temperature-grown homozygotes are allowed to produce progeny at 25C, the percentage of sterile offspring is 75-85%; at 26C the percentage of sterile offspring is 100%.

ssrIs1248 [ges-1p(deltaB)::rpl-22::3xHA + ges-1p(deltaB)::GFP + pSM(empty vector)]. ges-1p(deltaB) is an INT1-specific promoter. Strain can be used for INT1-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215

ssrIs1251 [pho-1p::rpl-22::3xHA + pho-1p::mCherry + pSM(empty vector)]. pho-1p is an INT2-9-specific promoter. Strain can be used for INT2-9-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215

Starved appearance: shorter body length, pale intestine, reduced pharyngeal pumping, smaller brood size and extended egg-laing period.

CRISPR/Cas9-engineered insertion of GFP tag into the large AO13 splice isoform of the endogenous unc-44 locus at amino acid 6303. Slightly reduced body bends while crawling. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Heterozygotes are Rollers and segregate Rollers, Hmr inviable embyros and Egl Unc. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. itr-1(jc5) is cold sensitive. Progeny of homozygotes reared at 15C exhibit 95% maternal effect lethality, while progeny of homozygotes reared at 20C exhibit 15.2% lethality. Arrested embryos are defective in epithelial morphogenesis. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3’UTR] II. rubSi7 [eft-3p::24xGCN4::T2A::tagBFP::H2B::tbb-2 3’UTR]) IV. SunTag system allows visualization of translation throughout development in real-time. This strain expresses a SunTag reporter mRNA (24xGCN4::T2A::tagBFP::H2B::tbb-2 3’UTR ) and a SunTag antibody (scFv::GFP). In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. rubSi7 was inserted into cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.

This strain expresses a SunTag antibody (scFv::GFP) throughout development. GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. rubSi6 [eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR] was inserted into ttTi5605, and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.

heSi149 [myo-3::CRE::tbb-2 3'UTR + unc-119(+)] X. Inserted at ttTi14024. Maintain at 15-25C. Expression of CRE recombinase in differentiated body wall muscle cells driven by the myo-3 promoter. [NOTE: this stock serves as a replacement for SV1461, which was found to be carrying an unidentified red fluorescent transgene in the background.] Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.

he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.

heIs9 [myo-3p::cyd-1 + myo-3p::cdk-4::Venus + myo-3p::GFP::H2B] IV. Expression of CYD-1, CDK-4::VENUS, and GFP::H2B in body wall muscles (BWM). Over-expression of tagged CYD-1 and tagged CDK-4 from integrated transgene causes incidental extra BWM nuclei. Expression levels are higher that those from heIs12 in SV860. Reference: Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362. PMID: 22102824

heIs12 [myo-3p::cyd-1 + myo-3p::cdk-4::Venus + myo-3p::GFP::H2B]. Expression of CYD-1, CDK-4::VENUS, and GFP::H2B in body wall muscles (BWM). Over-expression of tagged CYD-1 and tagged CDK-4 from integrated transgene causes incidental extra BWM nuclei. Expression levels are lower that those from heIs9 in SV857. Reference: Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362. PMID: 22102824

CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.

PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.]

otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.

Endogenous lem-3 locus carries GFP tag and two misense mutations in conserved residues [Y556A G558A] of GIY-YIG nuclease domain. Homozygous viable, though [Y556A G558A] mutants exhibit increased embryonic lethality after irradiation and abolished localization of GFP::LEM-3 at the midbodies. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.

Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.

Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.

uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Maintain at 15C. Give about 50% dead embryos at 15C. Gives 100% dead embryos at 20C and 25C.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.

Heterozygotes are WT and segregate WT, Lon males, and dead eggs. sdc-2(y74)/sdc-2(y74) is lethal, although about 3% of the animals escape the lethality. These animals are extremely Dpy, extensively masculinized, and never fertile.

Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.

vps-34 [Y752C] #2. StyI restriction site created by synonymous changes, ease for genotyping. vps-34 [Y752C] are wild-type for the following phenotypes: Length, Width, Body wavelength, Crawl speed, Thrash rate, Pharyngeal Pump frequency, duration, R/E ratio, Germ cell corpse engulfment, coelomocyte endocytosis, coelomocyte size, gut vesicle size, and RAB-7(+) gut vesicle size.

jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).

Isolated from the soil in a kabocha pumpkin patch garden (Baermann funnel method) in Kurtistown (native Hawaiian place name: Ola'a), Hawaii Island, on June 24, 2008.

leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.

leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.

Temperature sensitive missense allele. Larval lethal and Vul at 25C. About WT at 20C. Previously called let-341.

Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.