Strain Information
| Name | VC2035 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | K12H6.12(gk1058) II. |
| Description | This strain is homozygous for a deletion (gk1058) in K12H6.12, detectable by PCR using the following primers. External left primer: CTGCGTCTCTCACTTTTCCC. External right primer: CTTCGTTGCAGACACTTGGA. Internal left primer: GGAGGAGAACAATGGCTCAA. Internal right primer: AGCTGAGTAACGGCGATTTG. Internal WT amplicon: 2398 bp. Deletion size: 1627 bp. Note: Internal right primer binding site deleted in gk1058. Deletion product from nested PCR runs at about 1150 bp. Deletion left flank: AATTATAATCATGTGGCGAAGCACATGAAA. Deletion right flank: AAATCAATATTTTCCATTGTTCTTGATGCT. Insertion Sequence: CTTTGAAAATATTTGAATTTAGCGGGAAATTCAAAATTTTTTGAGAAAAAGCTTTGGCG GGATTTTCAAAATCTTTGAAAAAAAAACACATTTCGGCGGGAATTTCAAATTTCCTGAC AAAGCTCTTCGGCGGTAAAATACCATTTTTTTCAGAAAATTTTCGATTAAAGAATTAGG ATTAAATTTTTTAAGAAAAAAAAGCAGT. Validation: PCR, CGH diagnostics for gk1058 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| Mutagen | UV/TMP |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.