Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
WBM1364 C. elegans wbmIs119 V. Show Description
wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1470 C. elegans wbmIs131 V. Show Description
wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1471 C. elegans wbmIs133 V. Show Description
wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WE5172 C. elegans dpy-5(e907) I; ajIs1 X. Show Description
ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.
WH171 C. elegans eff-1(oj55) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
WH346 C. elegans unc-119(ed3) III; ojIs34. Show Description
ojIs34 [GFP::car-1 + unc-119(+)]. N'-tagged GFP::CAR-1 (Y18D10A.17) fusion. Labels P-granules and small cytoplasmic puncta in all cells. Bombardment with pNL1.6::GFP::unc-119 (pfj-1::pie-1 promoter driving GFP::Y18D10A.17 (N-terminal) with unc-119 rescuing fragment).
WHY10 C. elegans glh-1(how3[3xHA::TurboID::glh-1]) I. Show Description
3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.
WJA1097 C. elegans rps-10(srf0825[K125R]) rps-20(srf1046[K6R+K9R]) unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Nuclear body wall muscle GFP+.
WJA780 C. elegans unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I.; nonu-1(srf780) III. Show Description
srf780 is a deletion of the Smr nuclease domain of nonu-1. Unc. GFP expression in body wall muscle. Reference: Glover ML, et al. Cell Rep. 2020 Mar 31;30(13):4321-4331.e4. doi: 10.1016/j.celrep.2020.03.023. PMID: 32234470.
WRM2 C. elegans sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WU1854 C. elegans pcn-1(am315[3xFLAG]) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12.
WU321 C. elegans cgr-1(n2528) X. Show Description
Slow growing at 20C. About 50% larval lethality at 15C. Maintain at 20C.
XA1433 C. elegans unc-36(e251) III; qaIs1400. Show Description
qaIs1400 [hsp16-2::ptx + unc-36(+)]. ptx is the gene for pertussis toxin S1 subunit from Bordetella pertussis.
XA4900 C. elegans rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
XA6401 C. elegans qaEx6401. Show Description
qaEx6401 [hlh-17::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression in sheath cells of cephalic sensilia. Transmission frequency is about 38%.
XA780 C. elegans gna-2(qa705)/goa-1(n499) I. Show Description
Heterozygotes are Egl and Paralyzed. Segregate embryonic lethals (n499) homozygotes. Segregates WT animals that lay only non-refractile eggs that fail to hatch. Pick paralyzed Egl worms to maintain (eggs on the plate should all be pale brown and non-refractile; presence of refractile eggs indicates a recombination has occurred). XA780 recombines at a frequency of about 1%.
XA8400 C. elegans qaIs8400. Show Description
qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.
XA900 C. elegans clh-1(qa900) II. Show Description
Exhibit wider body and abnormal alae structure.
XA901 C. elegans clh-1(qa901) II. Show Description
Exhibit wider body and abnormal alae structure.
XE1995 C. elegans wpIs98 I; ric-7(n2657) V; wpIs103. Show Description
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  ric-7 causes defective expulsion during defecation and slightly slow growth. Chrimson is expressed in DA9. GCaMP6 expressed in body wall muscles. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
XE1998 C. elegans wpls103. Show Description
wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  GCaMP6 expressed in body wall muscles. Can be used to monitor the activity of postsynaptic body wall muscles (BWM) during DA9 regeneration. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
XE2046 C. elegans oyIs14 ric-7(n2657) V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. sra-6p::GFP marks both PVQ neurons as well as the ASI and ASH neurons in the head. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE2260 C. elegans casy-1(wp78) II. Show Description
wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE2789 C. elegans pha-1(e2123) III; ccIs4595 IV; wpEx482. Show Description
ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
YK31 C. elegans tbx-9(ms31) III. Show Description
Deletion of 3.0 kb of the genomic region that extends from 2.1 kb upstream to the middle of the tbx-9 gene. Incompletely penetrant morphogenic defects in embryogenesis. Failure in proper formation of hypodermis and body-wall muscle.
YL651 C. elegans let-607(tm1423) I; unc-119(ed3) III; vrIs121. Show Description
vrIs121 [let-607(fosmid)::GFP + unc-119(+)]. let-607 locus in fosmid tagged at the carboxy-terminus with GFP. Derived by crossing the LET-607::GFP transgenic strain (YL529) to let-607(tm1423) mutants. vrIs121 transgene rescues the lethal mutant phenotype of let-607(tm1423) homozygous mutants. Reference: Weicksel SE, et al. Development. 2016 Oct 1;143(19):3540-3548.
ZD39 C. elegans agIs219 III; pmk-1(km25) IV. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Intestinal GFP expression from agIs219 is abolished by km25. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
ZM10393 C. elegans hpIs592; hpIs595. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10410 C. elegans gbb-2(tm1165) IV; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10441 C. elegans unc-49(e407) III; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10806 C. elegans hpIs824. Show Description
hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement.
ZM11082 C. elegans twk-40(hp834) III; hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.
ZM11086 C. elegans hpEx4362. Show Description
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.
ZM2246 C. elegans hpIs88. Show Description
hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM54 C. elegans hpIs3 X. Show Description
hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
ZM7646 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7696 C. elegans hpIs376. Show Description
hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7798 C. elegans hpIs372. Show Description
hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM8230 C. elegans ubr-1(hp684) I. Show Description
hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.
ZM8607 C. elegans hpIs481. Show Description
hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9062 C. elegans hpIs583. Show Description
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9078 C. elegans hpIs587. Show Description
hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM9123 C. elegans hpIs590. Show Description
hpIs590 [ttr-39p::tomm20::miniSOG::SL2::BFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9140 C. elegans hpIs600. Show Description
hpIs600 [myo-3p::GCaMP6::wCherry + lin-15(+)]. GFP and RFP in body wall muscles. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM9429 C. elegans zxIs6; ljIs131. Show Description
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Body contracts and coils dorsally upon blue light illumination on ATR plates. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM9585 C. elegans hpIs615; hpIs365. Show Description
hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZR1 C. elegans rbr-2(tm1231) IV. Show Description
648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul).
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
ZW129 C. elegans unc-68(r1162) V; zwIs108. Show Description
zwIs108 [myo-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Locomotion is similar to unc-68(r1162).
ZW495 C. elegans zwIs132. Show Description
zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.