Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB2599 C. elegans C08E3.4(ok3621) II. Show Description
C08E3.4 Homozygous. Outer Left Sequence: caacttgagacatggtgcgt. Outer Right Sequence: atgtctgttgctctttgcca. Inner Left Sequence: gccaagaccacattgagaca. Inner Right Sequence: tctctacgaagttctcgacaaaaa. Inner Primer PCR Length: 1155. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2600 C. elegans hsp-12.1(ok3622) I. Show Description
T22A3.2 Homozygous. Outer Left Sequence: ttgaaaatgtttcttcgggg. Outer Right Sequence: aattacaactgactcggcgg. Inner Left Sequence: tgccagaaacttccagttca. Inner Right Sequence: gccccttcagcataacgat. Inner Primer PCR Length: 1319. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2601 C. elegans M01G12.14(ok3623) I. Show Description
M01G12.14 Homozygous. Outer Left Sequence: aaccgattcctcatccctct. Outer Right Sequence: aggggtcacacacagacaca. Inner Left Sequence: ccacctggatctttcaccat. Inner Right Sequence: ttgattgaacgctgtgaagg. Inner Primer PCR Length: 1305. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2602 C. elegans F01G10.1(ok3624) IV. Show Description
F01G10.1 Homozygous. Outer Left Sequence: gtggacatcccacgtcttct. Outer Right Sequence: ttgctcctgggatagtacgg. Inner Left Sequence: aagtacgatgtcgcagagcc. Inner Right Sequence: caattgagactccgacgtga. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2603 C. elegans ftn-1(ok3625) V. Show Description
C54F6.14 Homozygous. Outer Left Sequence: atgtgtctcagatttccgcc. Outer Right Sequence: gaaccctttcgttgccaata. Inner Left Sequence: ggttgaacctttttaggaactgc. Inner Right Sequence: acagtcccggacacgtaatc. Inner Primer PCR Length: 1178. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2604 C. elegans W02G9.4(ok3626) V. Show Description
W02G9.4 Homozygous. Outer Left Sequence: taccctgacattatccccca. Outer Right Sequence: ctaggtttcagatcgcctgc. Inner Left Sequence: ccaacccaattcctcttcaa. Inner Right Sequence: ccttagtccgctttaggtcg. Inner Primer PCR Length: 1094. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2605 C. elegans grl-13(ok3627) V. Show Description
F32D1.4 Homozygous. Outer Left Sequence: atatgccaagcaaatctggc. Outer Right Sequence: gaaatttgtcggattcaccg. Inner Left Sequence: aaatcgaattggctgcagat. Inner Right Sequence: ccagtttcagtcgttcccat. Inner Primer PCR Length: 1107. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2606 C. elegans T12E12.6(ok3632) IV. Show Description
T12E12.6 Homozygous. Outer Left Sequence: agatgagaaacggagagcca. Outer Right Sequence: ggggatttcttcgaatcaga. Inner Left Sequence: cgtacaacttgagcaaaaagtga. Inner Right Sequence: tgttttacccacgtaaaatgga. Inner Primer PCR Length: 1203. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2607 C. elegans ugt-49(ok3633) V. Show Description
AC3.2 Homozygous. Outer Left Sequence: cgtgtgatggtgacaagacc. Outer Right Sequence: agaacagcaacgaacacgaa. Inner Left Sequence: acgtggcattcagtgaacaa. Inner Right Sequence: ggacaaaagcaataacatcaaga. Inner Primer PCR Length: 1279. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2608 C. elegans M03C11.3(ok3634) III. Show Description
M03C11.3 Homozygous. Outer Left Sequence: aggtgctgttgagtcctgct. Outer Right Sequence: ttctctcctcgtccacgact. Inner Left Sequence: aaattccacaaaatccgctg. Inner Right Sequence: ccgggaacatccaaactg. Inner Primer PCR Length: 1090. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2609 C. elegans lsm-3(ok3635) IV. Show Description
Y62E10A.12 Homozygous. Outer Left Sequence: actatgtgagccctgaacgg. Outer Right Sequence: gagatttttcaaacggcgaa. Inner Left Sequence: ggctggaaagtgaattgagc. Inner Right Sequence: cagccatgtgtcgatttatga. Inner Primer PCR Length: 1360. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2610 C. elegans F40F12.5(ok3637) III. Show Description
F40F12.5 Homozygous. Outer Left Sequence: aaacgattccatccttgcag. Outer Right Sequence: aactggatgaggatgttccg. Inner Left Sequence: tcggacatatttccacattctc. Inner Right Sequence: gaagcacaatcattcgggat. Inner Primer PCR Length: 1234. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2612 C. elegans hsp-12.2(ok3638) III. Show Description
C14B9.1 Homozygous. Outer Left Sequence: tttcaggtccacaacaccaa. Outer Right Sequence: aaaatcatccctcgatgtgc. Inner Left Sequence: agttcgaggtcggacttgac. Inner Right Sequence: cattattcgtgcgttgatgc. Inner Primer PCR Length: 1096. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2613 C. elegans H06O01.2(ok2798) I. Show Description
H06O01.2 Homozygous. Outer Left Sequence: gggaagattggggaaaagaa. Outer Right Sequence: tgcacaaaaagcttgaacca. Inner Left Sequence: catcgaaaactttcggaatga. Inner Right Sequence: ggctcaccagaagcagtttt. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2614 C. elegans Y55B1BR.2(ok3639) III. Show Description
Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2615 C. elegans syg-1(ok3640) X. Show Description
K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2616 C. elegans srh-174(ok3641) V. Show Description
F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2617 C. elegans Y106G6G.2(ok2830) I. Show Description
Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2618 C. elegans T27E9.4(ok3642) III. Show Description
T27E9.4 Homozygous. Outer Left Sequence: gaatgttcgcatctgacgtg. Outer Right Sequence: cgcagcgacatacacttgtt. Inner Left Sequence: attgcgaaaatccccctcta. Inner Right Sequence: aatctttaaaggcgcacacg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2619 C. elegans K01A2.11(ok3646) II. Show Description
K01A2.11 Homozygous. Outer Left Sequence: ccgtccaaatcgaattccta. Outer Right Sequence: agacgaagagttcggggaat. Inner Left Sequence: tcccagctatgggagcttta. Inner Right Sequence: taccatgtcacgcgatgttt. Inner Primer PCR Length: 1123. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2620 C. elegans daf-14(ok3647) IV. Show Description
F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2622 C. elegans gcy-27(ok3653) IV. Show Description
C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2623 C. elegans F39B2.7(ok3674) I. Show Description
F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2624 C. elegans Y105C5B.12(ok3675) IV. Show Description
Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2625 C. elegans F40F12.7(ok3684) III. Show Description
F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2626 C. elegans R03A10.6(ok3685) X. Show Description
R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2627 C. elegans srg-69(ok3686) II. Show Description
F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2628 C. elegans Y73B3B.2(ok3687) X. Show Description
Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2629 C. elegans Y46G5A.35(ok3697) II. Show Description
Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB5000 C. elegans dpy-1(ok5083) III. Show Description
Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
RB5001 C. elegans Show Description
Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
RB5002 C. elegans Show Description
Whole-genome sequenced strain. Unc. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 477 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
RB509 C. elegans F54D7.3(ok238) I. Show Description
F54D7.3 Homozygous. Outer Left Sequence: CATAATCCCCTGAACCCCTT. Outer Right Sequence: CACCTGCTAACATTCGCTGA. Inner Left Sequence: TCAATCAGTGCACCTTTTCG. Inner Right Sequence: CGAATATCCTTCGGAATCCA. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB563 C. elegans aaim-1(ok295) X. Show Description
Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB582 C. elegans C04G6.1(ok219) II. Show Description
C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB637 C. elegans F22A3.1(ok165) X. Show Description
F22A3.1 Homozygous. Outer Left Sequence: CACATCCGATGGATATGCCATGC. Outer Right Sequence: AATGTCGATATATTTGATGTGTTGGC. Inner Left Sequence: CCCATCGAGTATAACCGTCG. Inner Right Sequence: CATTGCGATTCCCATGTAACC. Inner Primer PCR Product: 3203. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB815 C. elegans F18F11.3(ok628) IV. Show Description
F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB820 C. elegans bmk-1(ok391) V. Show Description
F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB821 C. elegans clh-2(ok636) II. Show Description
B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB831 C. elegans tbx-8(ok656) III. Show Description
T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB840 C. elegans nhr-40(ok667) X. Show Description
T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB875 C. elegans baz-2&ZK783.6(ok722) III. Show Description
ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB879 C. elegans wnk-1(ok266) IV. Show Description
C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB898 C. elegans C54D10.10(ok757) V. Show Description
C54D10.10 Homozygous. Outer Left Sequence: ATTGGGAAGTTGGTGAATGG. Outer Right Sequence: CTTCGTGCCACATTTTCTGA. Inner Left Sequence: AAGTTCCGAGGCGATATTCA. Inner Right Sequence: CAAAGCGATGCACCGTAATA. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB899 C. elegans C17G1.7(ok762) X. Show Description
C17G1.7 Homozygous. Outer Left Sequence: GTCTCGTTGGCCACCACTAT. Outer Right Sequence: CAGCTGATTGTGCATTCGTT. Inner Left Sequence: TCATGAGACATCGACAAGCC. Inner Right Sequence: TTTGGTGTCAAAACCAGCAG. Inner Primer PCR Length: 2272. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB900 C. elegans clh-3(ok763). Show Description
E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB901 C. elegans nex-2(ok764) I. Show Description
T07C4.9 Homozygous. Outer Left Sequence: TGATTCATCGAAGGTCACCA. Outer Right Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Left Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Right Sequence: GATGGCCGTGATCTACCAGT. Inner Primer PCR Length: 3043. Estimated Deletion Size: about 500 bp. Update added 2/04: Work completed by Arseni Markoff: Deletion is 404 bp, starts at genomic position 2874 (+/- AATA) from atg (+1) of the gene and ends 3277 +/-4. Thus it begins 18 +/-4 bp from the end of exon 4 and lies entirely in intron 4 of the gene (I-4 is 927 bp). I checked if a possible branching site in the intron should be affected by this deletion, but it seems not to be the case. Our conclusion is that the deletion represents a non-functional mutation. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB902 C. elegans jamp-1(ok765) V. Show Description
R01B10.5 Homozygous. Outer Left Sequence: CGTTATTAAAAGGCACCCGA. Outer Right Sequence: CCATGTCATCATTGTCTGGC. Inner Left Sequence: TCTTTGGAAATTCGGGTGAC. Inner Right Sequence: GCCATCATGTCTCGGATTCT. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB903 C. elegans kin-23(ok766) I. Show Description
W04G5.6 Homozygous. Outer Left Sequence: GCAATCGGCATCAAGAAGAT. Outer Right Sequence: GAATTTTTCCCCGTTTGGAT. Inner Left Sequence: GAGAAAAGCAGTGTACGGGC. Inner Right Sequence: TGGAAACCGATGCCATTATT. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB904 C. elegans bath-47(ok767) II. Show Description
T07H3.1 Homozygous. Outer Left Sequence: CTTTCCAGCTGGCCAAATAA. Outer Right Sequence: AGGAAACAGCTCCGAAGTCA. Inner Left Sequence: TTGCTCCCAGTGAATTTTCC. Inner Right Sequence: GTGGAGGGTGTGCTTCTCAT. Inner Primer PCR Length: 3105. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807