Search Strains

Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.4 Homozygous. Outer Left Sequence: gaatgttcgcatctgacgtg. Outer Right Sequence: cgcagcgacatacacttgtt. Inner Left Sequence: attgcgaaaatccccctcta. Inner Right Sequence: aatctttaaaggcgcacacg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A2.11 Homozygous. Outer Left Sequence: ccgtccaaatcgaattccta. Outer Right Sequence: agacgaagagttcggggaat. Inner Left Sequence: tcccagctatgggagcttta. Inner Right Sequence: taccatgtcacgcgatgttt. Inner Primer PCR Length: 1123. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Whole-genome sequenced strain. Unc. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 477 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

F54D7.3 Homozygous. Outer Left Sequence: CATAATCCCCTGAACCCCTT. Outer Right Sequence: CACCTGCTAACATTCGCTGA. Inner Left Sequence: TCAATCAGTGCACCTTTTCG. Inner Right Sequence: CGAATATCCTTCGGAATCCA. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22A3.1 Homozygous. Outer Left Sequence: CACATCCGATGGATATGCCATGC. Outer Right Sequence: AATGTCGATATATTTGATGTGTTGGC. Inner Left Sequence: CCCATCGAGTATAACCGTCG. Inner Right Sequence: CATTGCGATTCCCATGTAACC. Inner Primer PCR Product: 3203. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54D10.10 Homozygous. Outer Left Sequence: ATTGGGAAGTTGGTGAATGG. Outer Right Sequence: CTTCGTGCCACATTTTCTGA. Inner Left Sequence: AAGTTCCGAGGCGATATTCA. Inner Right Sequence: CAAAGCGATGCACCGTAATA. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G1.7 Homozygous. Outer Left Sequence: GTCTCGTTGGCCACCACTAT. Outer Right Sequence: CAGCTGATTGTGCATTCGTT. Inner Left Sequence: TCATGAGACATCGACAAGCC. Inner Right Sequence: TTTGGTGTCAAAACCAGCAG. Inner Primer PCR Length: 2272. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C4.9 Homozygous. Outer Left Sequence: TGATTCATCGAAGGTCACCA. Outer Right Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Left Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Right Sequence: GATGGCCGTGATCTACCAGT. Inner Primer PCR Length: 3043. Estimated Deletion Size: about 500 bp. Update added 2/04: Work completed by Arseni Markoff: Deletion is 404 bp, starts at genomic position 2874 (+/- AATA) from atg (+1) of the gene and ends 3277 +/-4. Thus it begins 18 +/-4 bp from the end of exon 4 and lies entirely in intron 4 of the gene (I-4 is 927 bp). I checked if a possible branching site in the intron should be affected by this deletion, but it seems not to be the case. Our conclusion is that the deletion represents a non-functional mutation. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01B10.5 Homozygous. Outer Left Sequence: CGTTATTAAAAGGCACCCGA. Outer Right Sequence: CCATGTCATCATTGTCTGGC. Inner Left Sequence: TCTTTGGAAATTCGGGTGAC. Inner Right Sequence: GCCATCATGTCTCGGATTCT. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04G5.6 Homozygous. Outer Left Sequence: GCAATCGGCATCAAGAAGAT. Outer Right Sequence: GAATTTTTCCCCGTTTGGAT. Inner Left Sequence: GAGAAAAGCAGTGTACGGGC. Inner Right Sequence: TGGAAACCGATGCCATTATT. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07H3.1 Homozygous. Outer Left Sequence: CTTTCCAGCTGGCCAAATAA. Outer Right Sequence: AGGAAACAGCTCCGAAGTCA. Inner Left Sequence: TTGCTCCCAGTGAATTTTCC. Inner Right Sequence: GTGGAGGGTGTGCTTCTCAT. Inner Primer PCR Length: 3105. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04D3.4 Homozygous. Outer Left Sequence: CCGTAGGTGACTGTCGGTTT. Outer Right Sequence: TAGAAGGCTAACCCACGCAT. Inner Left Sequence: GTAGTTGACGGCAAAACCGT. Inner Right Sequence: GCGAAAAAGGCTTGTGGTAG. Inner Primer PCR Length: 3123. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C11D9.1 Homozygous. Outer Left Sequence: TTTTGGTGAAAGCCTTGGTC. Outer Right Sequence: CATCATTTGGCATTTCGTTG. Inner Left Sequence: CGTCTCAACAGATTCAGCCA. Inner Right Sequence: ATGGTCATGGTCGGTCATTT. Inner Primer PCR Length: 2609. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21A9.2 Homozygous. Outer Left Sequence: ATATGCGTACGAATCCCTCG. Outer Right Sequence: CTCACTCGAGCCCATCTTTC. Inner Left Sequence: GTCTTCGTTGTCTGATGCGA. Inner Right Sequence: CTCATTCGGCCACTTCATTT. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2024.3 Homozygous. Outer Left Sequence: CATTGTTTTGTCGCCTCCTT. Outer Right Sequence: GCCTCTGATGATTAGCCGAA. Inner Left Sequence: ATCGACAACATGGATGCAAA. Inner Right Sequence: ACACAAATCGTCTCTTCCGC. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50H2.1 Homozygous. Outer Left Sequence: TTGCCCAGACAAAACATTCA. Outer Right Sequence: AATCCAATTGTGGCCGTAAA. Inner Left Sequence: TGTTCAGGGTTAAGTTCGGG. Inner Right Sequence: CCAAAGAACAGGGTTGGAAA. Inner Primer PCR Length: 3352. Estimated Deletion Size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10C3.3 Homozygous. Outer Left Sequence: GAACCCCCTATTCATCGGTT. Outer Right Sequence: CATGCAGAGGCAAATAAGGC. Inner Left Sequence: AATTGGTCAAGCATGGGAAC. Inner Right Sequence: AGTGGGTACACCCATTGGAA. Inner Primer PCR Length: 2953. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK994.3 Homozygous. Outer Left Sequence: CCAGCATCAAGGAAATGGTT. Outer Right Sequence: ACGCCTCCTTGTGTCAGAAC. Inner Left Sequence: ACCACGGGATAATTCCTTCC. Inner Right Sequence: TTGATGATTGTATGGCCGAA. Inner Primer PCR Length: 2968. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37A1B.17 Homozygous. Outer Left Sequence: TTTGAACGAAAGAAGTGGGG. Outer Right Sequence: CCAACACGCACTTTTCATGT. Inner Left Sequence: CCTATCGATCCTTCAAGCCA. Inner Right Sequence: GTCTCTGGCTGGTCTATCGC. Inner Primer PCR Length: 2242. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25G6.3 Homozygous. Outer Left Sequence: CTTCATGCAACCCTTTCACA. Outer Right Sequence: AAAAGAAGACAGGTGCCACG. Inner Left Sequence: CAGGAGCGCAGATTGTATGA. Inner Right Sequence: AGTCCTCTGGGCTTTCCATT. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03G9.1 Homozygous. Outer Left Sequence: ATTCCTGCAGCCTATCGTGT. Outer Right Sequence: GGTGGTGGTTCTGAAGTCGT. Inner Left Sequence: TCCGTTCTCTTCCTCACCAC. Inner Right Sequence: AGGCTTAGGAATGTGGGGTT. Inner Primer PCR Length: 3088. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B7.1 Homozygous. Outer Left Sequence: AACAAGTTCCCAAAACTGCG. Outer Right Sequence: AATGAAGATCCTGTGTCGGG. Inner Left Sequence: TGCGTACTTTTACCTCGGCT. Inner Right Sequence: ATGTTGGTCGAACGGATAGC. Inner Primer PCR Length: 3211. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11G6.8. Homozygous. Outer Left Sequence: GCCATCATGTCGATGTCAAA. Outer Right Sequence: CAGCGAATTTTTGCGATTTT. Inner Left Sequence: CCGGAAAAATTGGGAAGATT. Inner Right Sequence: GAAAATTCCGCTGAGACGAG. Inner Primer PCR Length: 3163. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35G2.4 Homozygous. Outer Left Sequence: GCAGGTACGCAGGCATTTAT. Outer Right Sequence: TTCAACATCCGTTCCACGTA. Inner Left Sequence: GTTGCAGGGCTCTTGCTTAC. Inner Right Sequence: TCCCTCTTCATCATCATCCC. Inner Primer PCR Length: 3083. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807