Search Strains

231 bp deletion removes all of exons 2 and 3 and throws the remaining portion of the proten (which contains the RGS domain) out of frame. Deletion endpoints are: GCAGCTCACGGAGCCCGGAGTT...CACCGTCGCCAAGACTTAGGTA.

This deletion removes most of exon1, all of exon 2, and most of exon 3. It removes a good chunk of the protein region, including the RGS domain.

167 bp deletion which takes out most of exon 3 and the first 42 bases of exon 4. The first 22 bp of the deletion are: TATGGCTGATATCCGCAGGAAT.

328 bp deletion which completely removes exons 8 and 9. The first 22 bp deleted are: cgttagtcccccttttaaaatt.

Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.

125 bp deletion. First 22 bp of deletion: AAGTATATTTTATTTTCAGGTA. Last 22 bp: GTGGCCATCATAGTTATGCCAT.

292 bp deletion. First 22 bp are: ACTTCCGTATTCCTTCTACTAC. Last 22 bp are: CTTAGCAGTTTCTGATTTTCTG.

This deletion removes sequence 5' to start of rgs-10 and may therefore remove promoter sequence for rgs-10&rgs-11.

Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA. ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele.

Phenotypically WT. Deletion allele. A "T" is added also. The end points of the deletion are: TCGAACGTCAACAACATATTGCAAAT.....t.....TTGGAAAGGTAGGCTTACACTT TTTTTAA.

vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA. Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA.

ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele. vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA.

Hypersensitive to hypoxia. Deletion corresponds to base pairs 13056-13629 in the published F08B12 sequence (genebank accession # Z68104).

Hypersensitive to hypoxia. Deletion corresponds to base pairs 13009-13380 in the published F08B12 sequence (genebank accession # Z68104).

Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.

A deletion in F22B7.7 corresponding to base pairs #9512-9815 in the published C. elegans cosmid F22B7 sequence (Genbank accession #L120180. Predicted protein F22B7.7 is part of a family of 2-pore domain potassium channels.

A 1215 bp deletion in C40C9.1 corresponding to base pairs #9009-10223 in the published C. elegans cosmid C40C9 sequence (Genbank accession #Z70266).

A 150 bp deletion in F44A2.2 corresponding to base pairs #27451-27600 in the published C. elegans cosmid F44A2 sequence (Genbank accession #U41993). The predicted protein F44A2.2 is called "nshab1", which is homologous to potassium voltage-gated channel subfamily B, member 2.

Full CRISPR deletion of sqst-1 locus. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.

abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Embryonic-lethal at 25ºC due to dominant gain-of-function mutation mei-1(ct46), and Uncoordinated due to unc-13 mutation. Maternal expression of EBP-2::GFP microtubule end-binding protein. EBP-2 encodes an EB1-like protein (end-binding) that, in early embryos, locates to the growing tips of microtubules. A strong fluorescent signal localizes to the centrosomes of early embryos due to a high concentration of polymerizing microtubules. mei-1(ct46)-based ectopic microtubule severing causes mitotic spindle defects in the early embryo. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.

Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Deletion allele of each microRNA. For mir-1829a, the entire intron is deleted to minimize disruption of host gene, gas-1. sgRNA #1: CGAGGACTGAAGGAGGAACG; sgRNA #2: GGAGGCGGAAGCTACCTGCG; sgRNA #3: GCGGTAACAGAGAGAACATG; sgRNA #4: GCTTCCTCGTCCTGCCGCCG; sgRNA #5: GTTTTCAAAACAGGGGGAGG; sgRNA #6: GCGACAGCAGAAAGAGCATG; sgRNA #7: GACGCAACCACTTTGGCCAC; sgRNA #8: ACGTGAGCTCTATAACTAAC; sgRNA #9: ATGGAACCGGAAAACCATAT; sgRNA #10: AGTGAGCAAACCCTGGAGCG; sgRNA #11: GCTACCATAGGCACCACGAG. Guide RNAs were injected in three rounds of CRISPR. sgRNAs #7-8 did not result in edits at the mir-1829a locus. sgRNA #11 was for co-CRISPR to mark jackpot founder plates.Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.

Deletion allele of each microRNA with an efficient CRISPR protospacer sequence (TGTATCAGTTCGATATCTGA) inserted at each locus to facilitate subsequent CRISPR modification. sgRNA #1: GTTGCTCCAGGAGCATGGTT; sgRNA #2: CTGAAGCGAGTTGGAAATAG; sgRNA #3: CTGAAGGTCCCGTCAGAGCT; sgRNA #4: CAGGTCCTCACATCAGTGCG; sgRNA #5: GCTACCATAGGCACCACGAG. sgRNA #5 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.

Deletion allele.

otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. ot406 has a dopaminergic phenotype. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(ok541); ceh-40(gk159) double mutants is rescued by muEx261.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP at C terminus + odr-1::RFP(su1006)]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261. ot406 has a dopaminergic phenotype.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261.

Heterochronic defects (Egl, increased number of seam cells, patchy alae). ae38 is a putative null allele caused by an insertion/deletion frameshift: CGATATCCACCTCAATCCAAAGTTGTAGAA. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Cold-sensitive: Sterile at 15C. Maintain at 20-25C. Homozygous viable. Heterochronic defects (precocious alae at L3 molt, protruding vulva). ae43 is a deletion in the 5' UTR regulatory region: AATTACAGGTAAAACCAAGAATTGT------GGGAGTCAATCCAATGAGTTCTGT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Vulvaless. Heterochronic defects (increased number of seam cells, patchy alae). ae55 is a deletion that removes an essential seed sequence of the lin-4 miRNA (null allele). WT: GCCTGTTCCCTGAGACCTCAAGTGTGAGCGTTCTGAACAT; ae55: GCCTGTT--------TCTCAAGTGTGAGCGTTCTGAACAT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Cold sensitive: maintain at 20-25C. Vulvaless. Heterochronic defects (increased number of seam cells, patchy alae). Gain-of-function allele. 1381 bp deletion in 3' UTR of Cbr-lin-14: ae58: ATTCCAAAAAAAAATTCGCCCTCCTCGGAA. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Homozygous viable. Heterochronic defects (increased number of seam cells, patchy alae, bursting at vulva at adulthood). Genotype: Chr V. ae73 is a 2,897 bp deletion removing Cbr-mir-241 and Cbr-mir-48 miRNAs: AAATGCACGTATAGGATGGGCTTCTCGGGTTGGGACACAAACAACTCTTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Heterozygous strain. Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile worms (Cbr-trr-1), and animals that lack alae and burst at vulva (Cbr-lin-29). ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Heterozygotes are wild-type and segregates wild-type (Cbr-lin-41(ae76); Cbr-lin-29(ae75)/+), Dpy animals with weak precocious alae that sometimes arrest as L4 larvae (Cbr-lin-41(ae76); +/+), and animals lacking alae that burst at the vulva (Cbr-lin-41(ae76); Cbr-lin-29(ae75) double homozygotes). Homozygous Cbr-lin-29(ae75) is epistatic to Cbr-lin-41(ae76). Heterozygous Cbr-lin-29(ae75) supresses Cbr-lin-41(ae76) phenotype. ae76 is a weak loss-of-function allele of Cbr-lin-41 (frameshift insertion at the 5' end, but part of the protein is putatively expressed from a downstream start-codon): WT: ATGACCACCACCACGAGTACGGCAACGCTGACACTGGAAACCACCGACGGCGGTGAGCAGCAC; ae76: ATGACCACCAAACCACCACCACGAGTACGGCAACGCTGACACTGGAAACCACCGACGGCGGTGAGCAGCAC. ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Heterozygotes are wild-type and segregates wild-type (Cbr-lin-28(ae39); Cbr-lin-29(ae75)/+), animals with weak precocious alae that arrest as L4 larvae (Cbr-lin-28(ae39); +/+), and animals lacking alae that burst at the vulva (Cbr-lin-28(ae39); Cbr-lin-29(ae75) double homozygotes). Homozygous Cbr-lin-29(ae75) is epistatic to Cbr-lin-28(ae39). Heterozygous Cbr-lin-29(ae75) supresses Cbr-lin-28(ae39) phenotype. ae39 is a putative null allele of Cbr-lin-28 (deletion & frameshift): WT:GATGATAACACCGGGGAAGATCTTT; ae39:GAT--------CGTGGAAGATCTTT. ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Weak heterochronic phenotype (patches of precocious alae). ae39 is a putative null allele of Cbr-lin-28 (deletion & frameshift): WT:GATGATAACACCGGGGAAGATCTTT; ae39:GAT--------CGTGGAAGATCTTT. ae65 is a deletion in Cbr-mir-48 removing structural parts and essential seed sequence: GTTTTTCGATATCTCACATAGAAATAGAG< 2180 bp del. >ATTCCTCACATCGTCTGTCCTAACTCG. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Heterozygous strain. Heterozygotes are wild-type and segregate wild-type heterozygotes, Dpys, and arrested L4 worms (weak heterochronic defects). ae80 is a 1025 bp deletion removing most of functional Cbr-lin-28 domains; likely null allele. ae80: GATGATAAC<----->AAGGCTGGAAAATAGgcgtcgagaccatggagaac. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.

Animals are healthy and Unc. Synthetic lethal/hyperproliferation with lin-35.

Synthetic lethal with lin-35(n745). Temperature sensitive. Grow at 15 C.

Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal. Occasional larval lethality.

At 20C: 7% Egl, 22% larval lethal. Vulval lineages WT.

ts embryonic lethal. Grows at 15C, 20C. Lethal at 25C.

ts egg lethal. Will grow at 15C and 20C. Will not grow at 25C.

Temperature-sensitive embryonic lethal. Maintain at 15C. Some growth at 20C. Does not grow at 25C.

ts embryonic lethal. Grows at 15C, 20C. Lethal at 25C. [Also contains a temperature sensitive lin-12 hypomorphic allele called ar170. Has 2 anchor cells. Jane Hubbard, 3/96 See WBPaper00002483. See GS1369 for emb-5 reference strain.]

ts embryonic lethal. Grows at 15C.