Strain Information

Name ME563   View On Wormbase
Species C. briggsae
GenotypeCbr-lin-28(ae39) I; Cbr-lin-29(ae75)/+ II.
DescriptionHeterozygotes are wild-type and segregates wild-type (Cbr-lin-28(ae39); Cbr-lin-29(ae75)/+), animals with weak precocious alae that arrest as L4 larvae (Cbr-lin-28(ae39); +/+), and animals lacking alae that burst at the vulva (Cbr-lin-28(ae39); Cbr-lin-29(ae75) double homozygotes). Homozygous Cbr-lin-29(ae75) is epistatic to Cbr-lin-28(ae39). Heterozygous Cbr-lin-29(ae75) supresses Cbr-lin-28(ae39) phenotype. ae39 is a putative null allele of Cbr-lin-28 (deletion & frameshift): WT:GATGATAACACCGGGGAAGATCTTT; ae39:GAT--------CGTGGAAGATCTTT. ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
MutagenCrispr/Cas9
Outcrossedx1
Made byMaria Ivanova
Laboratory ME
Reference 10.1093/genetics/iyad177 (publication in progress)
Sign in or register an account if you want to order this strain.