Strain Information
| Name | ME563 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-lin-28(ae39) I; Cbr-lin-29(ae75)/+ II. |
| Description | Heterozygotes are wild-type and segregates wild-type (Cbr-lin-28(ae39); Cbr-lin-29(ae75)/+), animals with weak precocious alae that arrest as L4 larvae (Cbr-lin-28(ae39); +/+), and animals lacking alae that burst at the vulva (Cbr-lin-28(ae39); Cbr-lin-29(ae75) double homozygotes). Homozygous Cbr-lin-29(ae75) is epistatic to Cbr-lin-28(ae39). Heterozygous Cbr-lin-29(ae75) supresses Cbr-lin-28(ae39) phenotype. ae39 is a putative null allele of Cbr-lin-28 (deletion & frameshift): WT:GATGATAACACCGGGGAAGATCTTT; ae39:GAT--------CGTGGAAGATCTTT. ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.