Strain Information
| Name | ME562 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-lin-41(ae76) I; Cbr-lin-29(ae75)/+ II. |
| Description | Heterozygotes are wild-type and segregates wild-type (Cbr-lin-41(ae76); Cbr-lin-29(ae75)/+), Dpy animals with weak precocious alae that sometimes arrest as L4 larvae (Cbr-lin-41(ae76); +/+), and animals lacking alae that burst at the vulva (Cbr-lin-41(ae76); Cbr-lin-29(ae75) double homozygotes). Homozygous Cbr-lin-29(ae75) is epistatic to Cbr-lin-41(ae76). Heterozygous Cbr-lin-29(ae75) supresses Cbr-lin-41(ae76) phenotype. ae76 is a weak loss-of-function allele of Cbr-lin-41 (frameshift insertion at the 5' end, but part of the protein is putatively expressed from a downstream start-codon): WT:ATGACCACCACCACGAGTACGGCAACGCTGACACTGGAAACCACCGACGGCGGTGAGCAG CAC; ae76:ATGACCACCAAACCACCACCACGAGTACGGCAACGCTGACACTGGAAACCACCGACGGCG GTGAGCAGCAC. ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.