Search Strains

ts embryonic lethal. Grows at 15C, 20C. Lethal at 25C.

Temperature sensitive egg lethal. Maintain at 15C. Will grow at 20C, and a few leak through at 25.4C.

Temperature sensitive egg lethal. Maintain at 15C. Will grow at 20C, but not at 25C.

ts embryonic lethal. Grows at 15C. Does not grow reliably at 20C. Lethal at 25C.

Temperature sensitive egg lethal. Maintain at 15C. Some growth at 20C, no growth at 25C.

mcEx401 [mlc-4p::GFP::mlc-4(WT) + pie-1p::GFP::mlc-4(WT) + rol-6(su1006)]. Rollers. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT Rol, and segregate WT Rol, sterile Dpy (qC1 homozygotes), late embryonic - early larval lethal (mlc-4 homozygotes) and Sterile Rollers. Pick WT Rol and check for correct segregation of progeny to maintain. Reference: Gally C et al. Development. 2009 Sep;136(18):3109-19.

mcEx402 [mlc-4p::GFP::mlc-4(DD) + pie-1p::GFP::mlc-4(WT) + rol-6(su1006)]. Rollers. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT Rol, and segregate WT Rol, sterile Dpy (qC1 homozygotes), late embryonic - early larval lethal (mlc-4 homozygotes) and Sterile Rollers. Pick WT Rol and check for correct segregation of progeny to maintain. Reference: Gally C et al. Development. 2009 Sep;136(18):3109-19.

mcIs54 [dpy-7p::spas-1::SL2(operon)::mCherry + unc-119(+)] X. Dpy. Expression of Spastin transgene depletes microtubules specifically in the hypodermis, creating a Dpy phenotype. Reference: Quintin S, et al. Development. 2016 Jan 1;143(1):160-73.

Maintain at 15C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622.

Maintain at 15C. nmy-2(ne3409) allele induces embryonic lethality (cytokinesis defective) at 25C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622.

Heterozygotes are WT and segregate WT, embryonic lethals (embryos fail to elongate) and Sterile Uncs. mc14 identified as a mutation that leads to abnormal lin-26 expression.

Heterozygotes are WT and segregate dead eggs, DpyUncs and WT. lin-26(mc15) is a molecular null due to a deletion of most of lin-26 coding sequence.

Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).

Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

lucSi100 [hsp16.41::vhhGFP4::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a GFP-nanobody::zif-1 fusion transgene under a heat-shock promoter. Allows conditional depletion of GFP-tagged proteins in all tissues via heat-shock expression of anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). (Wang et al. (2017). A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)

lucSi102 [hsp16.41::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a zif-1 transgene under a heat-shock promoter. Used as control for MLC1092 or for conditional depletion of ZF1 degron-tagged proteins (aka ZF) in all tissues via heat-shock expression of ZIF-1. (Wang et al. (2017) A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)

Superficially wild-type. CRISPR/Cas9-engineered mir-236 deletion allele; miRNA hairpin replaced by unc-119.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

Superficially wild-type. CRISPR/Cas9-engineered mir-1 deletion allele (breakpoints: gcagaaaattactcaccattaaaacactaccacc

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

luc40 is a deletion of mir-790. luc40 mutants respond normally to CO2 as compared to mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119.

luc27 is a 300 bp deletion in the unc-2 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

luc32 is a 670 bp deletion in the hbl-1 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt).

Maternal effect slow growth. Lethal at 25C. Grow at 20C or 15C. See also WBPaper00002456.

Maternal effect uncoordinated. Progressive paralysis leading to full paralysis and rapid death after the 4th larval moult. Some embryonic and larval lethality.

Maternal effect uncoordinated. Lethargic, kinky jerky, ratchet-like movements in reverse. Constipated due to frequent absence of the expulsion contraction. 20% embryonic lethality. 16% embryonic lethality.

Maternal effect Uncoordinated and Dumpy. High degree of embryonic and larval lethality. Dpy phenotype only partially resuced. Hatchlings are of variable length, with poor movement. Adults are short and show kinky uncoordination.

Maternal effect uncoordinated. Stiff posterior body. Severly Unc when attempting to move backwards. Partially wasted posterior body. Some embryonic and larval lethality.

Maternally rescued slow growth. Post-embryonic development takes approximately 1.5 days longer then WT at 20C ( clk-2(qm37) is a ts embryonic lethal). Maintain at or below 20C.

Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.

Maternal effect uncoordinated. Progressive paralysis. Abnorml muscle anatomy. Some embryonic and larval lethality.

Maternal effect uncoordinated. Egg-laying defective. Some larval lethality. Full zygotic rescue. Almost complete maternal rescue, no maternal rescue of egg-laying defect. Neuroanatomical defects. Short excretory canals.

Maternally rescued variable abnormal. Some embryonic lethality and a high degree of larval lethality. Worms often have a hypertrophic left side of the head, generally anterior of the terminal bulb.

Maternal-effect morphologically abnormal. Variably deformed; frequent hypertrophic ventral side of the head. This strain has a high degree of embryonic and larval lethality. No zygotic rescue and full maternal rescue. Strict maternal effect. PKA mal-2.

Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 32% of embyros die. 80% of larvae die. 100% of adult survivors show a mutant phenotype.

Maternally rescued variable abnormal. Some embryonic lethality and a very high level of larval lethality. Head frequently deformed because the buccal cavity does not open at the tip of the head but ventrally, dorsally or laterally.

Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 15% of embyros die. 26% of larvae die. 100% of adult survivors show a mutant phenotype. Full zygotic and maternal rescue.

Maternally rescued Dpy. Fully zygotically rescued but only partially maternally rescued. Some embryonic lethality and a high degree of larval lethality. Very poor embryonic elongation. Hatchlings are short and deformed. In later stages the anterior half of the body is short but well developed while the posterior is thin.