Strain Information
| Name | ME567 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-lin-28(ae39) I; Cbr-mir-48(ae65) V. |
| Description | Weak heterochronic phenotype (patches of precocious alae). ae39 is a putative null allele of Cbr-lin-28 (deletion & frameshift): WT:GATGATAACACCGGGGAAGATCTTT; ae39:GAT--------CGTGGAAGATCTTT. ae65 is a deletion in Cbr-mir-48 removing structural parts and essential seed sequence: GTTTTTCGATATCTCACATAGAAATAGAG< 2180 bp del. >ATTCCTCACATCGTCTGTCCTAACTCG. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.