Strain Information

Name ME567   View On Wormbase
Species C. briggsae
GenotypeCbr-lin-28(ae39) I; Cbr-mir-48(ae65) V.
DescriptionWeak heterochronic phenotype (patches of precocious alae). ae39 is a putative null allele of Cbr-lin-28 (deletion & frameshift): WT:GATGATAACACCGGGGAAGATCTTT; ae39:GAT--------CGTGGAAGATCTTT. ae65 is a deletion in Cbr-mir-48 removing structural parts and essential seed sequence: GTTTTTCGATATCTCACATAGAAATAGAG< 2180 bp del. >ATTCCTCACATCGTCTGTCCTAACTCG. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
MutagenCrispr/Cas9
Outcrossedx1
Made byMaria Ivanova
Laboratory ME
Reference 10.1093/genetics/iyad177 (publication in progress)
Sign in or register an account if you want to order this strain.