More Fields
Strain Species Genotype
MT13015 C. elegans mir-72(n4130) II. Show Description
Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VC324 C. elegans mir-72(gk166) II. Show Description
F53G2.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MT17428 C. elegans mir-72(n4130) II; nDf47 X. Show Description
Reference: Curr Bio (2010) 20:367-73.
VL205 C. elegans unc-119(ed3) III; wwEx28. Show Description
wwEx28 [mir-72p::GFP + unc-119(+)]. Maintain by picking non-Unc.