Strain Information

Name ME548   View On Wormbase
Species C. briggsae
GenotypeCbr-trr-1(v76)/Cbr-lin-29(ae75) II.
DescriptionHeterozygous strain. Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile worms (Cbr-trr-1), and animals that lack alae and burst at vulva (Cbr-lin-29). ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
MutagenCrispr/Cas9
Outcrossedx1
Made byMaria Ivanova
Laboratory ME
Reference 10.1093/genetics/iyad177 (publication in progress)
Sign in or register an account if you want to order this strain.