Strain Information
| Name | ME548 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-trr-1(v76)/Cbr-lin-29(ae75) II. |
| Description | Heterozygous strain. Heterozygotes are wild-type and segregate wild-type heterozygotes, sterile worms (Cbr-trr-1), and animals that lack alae and burst at vulva (Cbr-lin-29). ae75 is a null allele of Cbr-lin-29 (deletion & frameshift): WT: TACCTCTCCCAACACATGCGAATCCATTT; ae75: TACCTCTC-----ACATGCGAATCCATTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.