Strain Information
| Name | ME538 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-mir-241&Cbr-mir-48(ae73) V. |
| Description | Homozygous viable. Heterochronic defects (increased number of seam cells, patchy alae, bursting at vulva at adulthood). Genotype: Chr V. ae73 is a 2,897 bp deletion removing Cbr-mir-241 and Cbr-mir-48 miRNAs: AAATGCACGTATAGGATGGGCTTCT |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.