Strain Information

Name ME538   View On Wormbase
Species C. briggsae
GenotypeCbr-mir-241&Cbr-mir-48(ae73) V.
DescriptionHomozygous viable. Heterochronic defects (increased number of seam cells, patchy alae, bursting at vulva at adulthood). Genotype: Chr V. ae73 is a 2,897 bp deletion removing Cbr-mir-241 and Cbr-mir-48 miRNAs: AAATGCACGTATAGGATGGGCTTCTCGGGTTGGGACACAAACAACTCTTT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
MutagenCrispr/Cas9
Outcrossedx1
Made byMaria Ivanova
Laboratory ME
Reference 10.1093/genetics/iyad177 (publication in progress)
Sign in or register an account if you want to order this strain.