Strain Information
| Name | ME514 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-lin-14(ae58) X. |
| Description | Cold sensitive: maintain at 20-25C. Vulvaless. Heterochronic defects (increased number of seam cells, patchy alae). Gain-of-function allele. 1381 bp deletion in 3' UTR of Cbr-lin-14: ae58: ATTCCAAAAAAAAATTCGCCCT |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.