Strain Information
| Name | ME500 View On Wormbase |
|---|---|
| Species | C. briggsae |
| Genotype | Cbr-lin-4(ae55) II. |
| Description | Vulvaless. Heterochronic defects (increased number of seam cells, patchy alae). ae55 is a deletion that removes an essential seed sequence of the lin-4 miRNA (null allele). WT: GCCTGTTCCCTGAGACCTCAAGTGTGAGCGTTCTGAACAT; ae55: GCCTGTT--------TCTCAAGTGTGAGCGTTCTGAACAT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Maria Ivanova |
| Laboratory | ME |
| Reference | 10.1093/genetics/iyad177 (publication in progress) |
Sign in
or
register an account if you want to order this strain.