Strain Information

Name ME500   View On Wormbase
Species C. briggsae
GenotypeCbr-lin-4(ae55) II.
DescriptionVulvaless. Heterochronic defects (increased number of seam cells, patchy alae). ae55 is a deletion that removes an essential seed sequence of the lin-4 miRNA (null allele). WT: GCCTGTTCCCTGAGACCTCAAGTGTGAGCGTTCTGAACAT; ae55: GCCTGTT--------TCTCAAGTGTGAGCGTTCTGAACAT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
MutagenCrispr/Cas9
Outcrossedx0
Made byMaria Ivanova
Laboratory ME
Reference 10.1093/genetics/iyad177 (publication in progress)
Sign in or register an account if you want to order this strain.