Strain Information
| Name | MCJ511 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | mir-72(cdb223) II; mir-63(cdb218) X. |
| Description | Deletion allele of each microRNA with an efficient CRISPR protospacer sequence (TGTATCAGTTCGATATCTGA) inserted at each locus to facilitate subsequent CRISPR modification. sgRNA #1: GTTGCTCCAGGAGCATGGTT; sgRNA #2: CTGAAGCGAGTTGGAAATAG; sgRNA #3: CTGAAGGTCCCGTCAGAGCT; sgRNA #4: CAGGTCCTCACATCAGTGCG; sgRNA #5: GCTACCATAGGCACCACGAG. sgRNA #5 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Katherine McJunkin |
| Laboratory | MCJ |
| Reference | Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
Sign in
or
register an account if you want to order this strain.