Strain Information
| Name | MCJ366 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | mir-4812(cdb175) mir-1829b(cdb163) mir-1829c(cdb164) mir-1829a(cbd199) X. |
| Description | Deletion allele of each microRNA. For mir-1829a, the entire intron is deleted to minimize disruption of host gene, gas-1. sgRNA #1: CGAGGACTGAAGGAGGAACG; sgRNA #2: GGAGGCGGAAGCTACCTGCG; sgRNA #3: GCGGTAACAGAGAGAACATG; sgRNA #4: GCTTCCTCGTCCTGCCGCCG; sgRNA #5: GTTTTCAAAACAGGGGGAGG; sgRNA #6: GCGACAGCAGAAAGAGCATG; sgRNA #7: GACGCAACCACTTTGGCCAC; sgRNA #8: ACGTGAGCTCTATAACTAAC; sgRNA #9: ATGGAACCGGAAAACCATAT; sgRNA #10: AGTGAGCAAACCCTGGAGCG; sgRNA #11: GCTACCATAGGCACCACGAG. Guide RNAs were injected in three rounds of CRISPR. sgRNAs #7-8 did not result in edits at the mir-1829a locus. sgRNA #11 was for co-CRISPR to mark jackpot founder plates.Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Rima Sakhawala |
| Laboratory | MCJ |
| Reference | Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. PMID: 40659526. |
Sign in
or
register an account if you want to order this strain.