Search Strains

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Abnormal-looking dauers form at 25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Clr fairly well suppressed by unc-51.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Very slow movement. Clr phenotyope is difficult to score.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc -- very slow. Grows very slowly.

utsIs3 [rab-11.2p::YFP::unc-54 3'UTR]. Transcriptional reporter for rab-11.2 activation. YFP expression is low at baseline and activated in the intestine by lipid depletion. Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.

syEx1341 [ges-1p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the intestine. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in the intestine. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1342 [myo-2p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + unc-122p::mCherry::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in the pharynx. Maintain at 25C and pick animals with red fluorescence in coelomocytes. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in pharyngeal muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1343 [myo-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed::unc-54 3' UTR + pha-1(+) + pBluescript]. GFP expression in body wall muscle. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in body wall muscle. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syEx1344 [rab-3p::fars-1(T412G)::fib-1::rps-16::GFP(S65C, SynIVS)::unc-54 3' UTR + myo-2p::DsRed + pha-1(+) + pBluescript]. GFP expression in neurons. Maintain at 25C and pick animals with red fluorescence in pharynx. Expresses a phenylalanyl-tRNA capable of tagging proteins with the non-canonical amino acid p-azido-L-phenylalanine in neurons. Reference: Yuet KP, et al. Proc Natl Acad Sci U S A. 2015 Mar 3;112(9):2705-10.

syIs300 [15xUAS::(delta)pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector.  Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs301 [myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs302 [15xUAS::?pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  nlp-40 cGAL driver for intestine.  NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III.  nlp-40 cGAL driver for the intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V.  nlp-40 cGAL driver for intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  myo-3 cGAL driver for body wall muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).

syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).

syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924

fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim GFP expression in pharynx, and segregate heterozygotes (not paralyzed, dim GFP), homozygous wild-type (not paralyzed, no GFP), and hIn1 homozygotes (paralyzed, bright GFP). Pick non-paralyzed, dim GFP worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived cross of parental strains CGC94 (hIn1[umnIs75]) to QP2460 (hIn1[umnIs78, unc-54(h1040)]/+) and selecting for the recombined hIn1 worms.

zjEx53 [gst-4p::tdTomato::unc-54 3'UTR]. Pick bright tdTomato to maintain the array. Worms with zjEx53 express tdTomato strongly throughout the body. Small and slow-growing with strong constitutive activation of SKN-1 and downstream detoxification genes. References: Choe KP, et al. Mol Cell Biol. 2009 May;29(10):2704-15. doi: 10.1128/MCB.01811-08. PMID: 19273594. Tang L, et al. Mech Ageing Dev. 2015 Jul;149:88-98. doi: 10.1016/j.mad.2015.06.001. PMID: 26056713.

zjIs5 [gst-4p::tdTomato::unc-54 3'UTR + unc-119(+)] II. Single copy insertion into ttTi5605 II. Fluorescence is dim; culture on 2-3 mM acrylamide to increase brightness. Reference: Tang L, et al. G3 (Besthesda). 2015 Dec 28;6(3):551–558. doi: 10.1534/g3.115.023010 PMID: 26715089.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.

unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. rpb-12 sgRNA #1: ggctgaacctgtatcatttt; rpb-12 sgRNA #2: ttaaagatattcagaATGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Emb. Deletion of 430 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve726 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttgcttaaattacttgtgtccttca ; Right flanking sequence: GGGAGGCGTGGACGGAGAAAACGAG. sgRNA #1: agggatatcgaaaatagtga; sgRNA #2: TGCAACAACGTTCTCTACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F31C3.3. Homozygous viable. Deletion of 8467 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtgtggtaccaaatgcacacaaacaacagc ; Right flanking sequence: CACAAAAGCGTGTCGGATGAGCTCGATCCC. sgRNA #1: gcagtaatatactcgggacg; sgRNA #2: TTTTGCGGTTCGATGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.