Strain Information
| Name | PX728 View On Wormbase |
|---|---|
| Species | C elegans |
| Genotype | fxSi11 I. |
| Description | fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014). |
| Mutagen | none |
| Outcrossed | x0 |
| Made by | Megan Moerdyk-Schauwecker and Erin Jahahn |
| Laboratory | PX |
| Reference | Micropub in preparation for submission |
Sign in
or
register an account if you want to order this strain.