More Fields
Strain Species Genotype
DR1564 C. elegans daf-2(m41) III. Show Description
Temperature-sensitive dauer-consitutive, long-lived, intrinsically thermotolerant. Adults slightly shorter than adults of other daf-2 alleles. Up to 6% of L1s arrest at 25.5C. Makes nearly 100% dauers at 25C, 0% dauers at 15C. Good recovery of dauers at 15C.
DR1942 C. elegans daf-2(e979) III. Show Description
This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]
NG41 C. elegans sex-1(gm41) X. Show Description
Egl. Dpy.
PJ1146 C. elegans daf-2(m41) III; ccIs55 V; pdk-1(mg142) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Gain of function allele of pdk-1.
PJ1166 C. elegans daf-2(m41) III; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
PJ1700 C. elegans daf-2(m41) III; unc-51(e369) ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc -- very slow. Grows very slowly.
DR966 C. elegans dpy-13(e184) ama-1(+) IV. Show Description
Dpy. Sensitive to alpha-amanitin. [NOTE: formerly described as ama-1(m118m370m414), it has been determined that m414 was reversion of m367 back to wild-type sequence.] Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR976 C. elegans dpy-13(e184) ama-1(m118m370m417) IV. Show Description
Dpy. Sensitive to alpha-amanitin. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR978 C. elegans daf-12(m419) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, and intestine. Class III allele.
EG3283 C. elegans nas-37(tm410) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.
HS1222 C. elegans pbrm-1(tm415) I. Show Description
Sys. Low penetrance Psa. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.
OH7158 C. elegans vtIs1 V; C52B9.2(tm413) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
SSM410 C. elegans rpa-2(ok1627) rpa-4(iow59[3xFLAG::rpa-4])I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
N-terminal 3xFLAG tag inserted into the endogenous rpa-4 locus using Crispr/Cas9. Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP heterozygotes, arrested hT2 aneuploids, and non-GFP ok1627 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. Generated in rpa-2(ok1627) background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
ZB2774 C. elegans Y32H12A.8(tm419) III. Show Description