Strain Information
Name | PX696 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | fxIs10 II. |
Description | fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG​) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924 |
Mutagen | none |
Outcrossed | x1 |
Made by | Megan Moerdyk-Schauwecker |
Laboratory | PX |
Reference | Manuscript submitted. Full citation not yet available |
Sign in
or
register an account if you want to order this strain.