Strain Information

Name PX727   View On Wormbase
Species C elegans
GenotypefxSi10 I.
DescriptionfxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
Mutagennone
Outcrossedx0
Made byMegan Moerdyk-Schauwecker and Erin Jahahn
Laboratory PX
Reference Micropub in preparation for submission
Sign in or register an account if you want to order this strain.