Strain Information
Name | PX736 View On Wormbase |
---|---|
Species | C elegans |
Genotype | fxSi13 III. |
Description | fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894). |
Mutagen | none |
Outcrossed | x0 |
Made by | Megan Moerdyk-Schauwecker and Erin Jahahn |
Laboratory | PX |
Reference | Micropub in preparation for submission |
Sign in
or
register an account if you want to order this strain.