Strain Information

Name PX736   View On Wormbase
Species C elegans
GenotypefxSi13 III.
DescriptionfxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
Mutagennone
Outcrossedx0
Made byMegan Moerdyk-Schauwecker and Erin Jahahn
Laboratory PX
Reference Micropub in preparation for submission
Sign in or register an account if you want to order this strain.