| BT14 |
C. elegans |
fbl-1(hd43)/dpy-20(e1282) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Steriles (hd43 homozygotes) and Dpy Uncs. |
|
| BW1932 |
C. elegans |
ctIs39. Show Description
ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53. |
|
| BW1940 |
C. elegans |
ctIs40 X. Show Description
ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressing line from injection of constructs ZC421 and pTG98. |
|
| CT11 |
C. elegans |
hbl-1(mg285) X. Show Description
Egl. Slightly Pvl. |
|
| ENL19 |
C. elegans |
mir-58.1(n4640) IV; ctIs40 X. Show Description
ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressiong from ctIs40. |
|
| ENL59 |
C. elegans |
sma-10(ok2224) IV; dbl-1(nk3) V. Show Description
Derived from RB1739 and NU3. |
|
| ENL60 |
C. elegans |
sma-10(ok2224) IV; ctIs40 X. Show Description
ctIs40 [dbl-1(+) + sur-5::GFP]. |
|
| ENL61 |
C. elegans |
mir-58.1(n4640) IV; dbl-1(nk3) V. Show Description
Small. Derived from MT15024 and NU3. |
|
| GR1719 |
C. elegans |
unc-119(ed3) III; mgSi3 IV. Show Description
mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616. |
|
| GR1720 |
C. elegans |
unc-119(ed3) III; mgSi4 IV. Show Description
mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616. |
|
| JDW1007 |
C. elegans |
wrdSi142 II; nas-31(wrd438[nas-31::7xGFP11::3xFLAG]) V. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd438 is an internal (2nd last exon; 63 amino acids from C-terminus) modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous nas-31 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW1008 |
C. elegans |
col-36(wrd439[col-36::7xGFP11::3xFLAG]) wrdSi142 II. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd439 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous col-36 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW1035 |
C. elegans |
wrdSi142 II; col-125(wrd449[col-125::7xGFP11::3xFLAG]) IV. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd449 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous col-125 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW1043 |
C. elegans |
nas-36(wrd452[nas-36::7xGFP11::3xFLAG]) I; wrdSi142 II. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd452 is an internal (36 aa from C-term) modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous nas-36 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW1044 |
C. elegans |
wrdSi142 II; cut-2(wrd453[cut-2::7xGFP11::3xFLAG]) V. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd453 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous cut-2 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW907 |
C. elegans |
wrdSi133 bli-1(wrd381[bli-1::7xGFP11::3xFLAG]) II. Show Description
Internal (exon 2; after amino acid 106) modular linker::7xGFP11::3xFLAG::linker tag inserted internatlly into the endogenous bli-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi133 [loxP myo-2p::NLS::mNeonGreen + rps-0p HygR + loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. Derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726. |
|
| JDW961 |
C. elegans |
wrdSi142 II; egl-3(wrd411[egl-3::7xGFP11::3xFLAG]) V. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd411 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous egl-3 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW962 |
C. elegans |
wrdSi142 II; osm-11(wrd412[osm-11::7xGFP11::3xFLAG]) X Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd412 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous osm-11 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW963 |
C. elegans |
wrdSi142 II; egl-20(wrd413[egl-20::7xGFP11::3xFLAG]) IV. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd413 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous egl-20 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW978 |
C. elegans |
wrdSi142 II; npa-1(wrd414[npa-1::7xGFP11::3xFLAG]) V. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd414 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous npa-1 locus by CRISPR/Cas9 RNP; tag was inserted internally but with recoded amino acids before the tag to make it a C-terminal fusion. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW979 |
C. elegans |
col-61(wrd415[col-61::3xGFP11::3xFLAG]) I; wrdSi142 II. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10:::ubl-1 3'UTR FRT3] II. wrd415 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous col-61 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW986 |
C. elegans |
wrdSi142 II; col-33(wrd420[col-33::7xGFP11::3xFLAG]) IV. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd420 is a C-terminal modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous col-33 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JDW987 |
C. elegans |
wrdSi142 II; col-34(wrd421[col-34::7xGFP11::3xFLAG]) IV. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd421 is an internal (last exon; 11 amino acids from C-terminus) modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous col-34 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. |
|
| JK3297 |
C. elegans |
fbl-1(q750) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate q750 homozygotes which are GFP- sterile adults, and dead eggs. Do not distribute this strain; other labs should request it from the CGC. |
|
| LT121 |
C. elegans |
dbl-1(wk70) V. Show Description
Small. Male tail ray fusions between rays 4 and 5, 6 and 7, 8 and 9. Crumpled spicules. Semidominant with respect to body size. |
|
| LW2308 |
C. elegans |
dbl-1(wk70) V; jjIs2277. Show Description
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84. |
|
| MLC618 |
C. elegans |
hbl-1(luc32) X. Show Description
luc32 is a 670 bp deletion in the hbl-1 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047. |
|
| NF773 |
C. elegans |
fbl-1(k201) IV. Show Description
Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k201) single mutant has weak DTC migration defects. |
|
| NF774 |
C. elegans |
fbl-1(k206) IV. Show Description
Isolated as a dominant suppressor of DTC migration defects of mig-17(k174). The fbl-1(k206) single mutant has weak DTC migration defects. |
|
| NF963 |
C. elegans |
fbl-1(tk45) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective. |
|
| NK2579 |
C. elegans |
fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. |
|
| NK2644 |
C. elegans |
lin-35(n745) I; fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214. |
|
| NU3 |
C. elegans |
dbl-1(nk3) V. Show Description
Previously called cet-1(kk3). Short, somewhat Dpy. Males have crumpled spicules and abnormal rays; Similar to sma-2, sma-3, sma-4, sma-6 and daf-4. |
|
| OP160 |
C. elegans |
unc-119(ed3) III; wgIs160. Show Description
wgIs160 [hbl-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). |
|
| OP664 |
C. elegans |
unc-119(tm4063) III; wgIs664. Show Description
wgIs664 [mbl-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). |
|
| PJ1215 |
C. elegans |
dbl-1(wk70) V; iwIs16 X. Show Description
iwIs16 [act-4::lacZ] X. Good lacZ expression in spermatheca, but weak in muscle. |
|
| RG3005 |
C. elegans |
Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| RG559 |
C. elegans |
hbl-1(ve18) X. Show Description
Pvul. Egl. Precocious alae. Heterochronic defects are suppressed in post-dauer stage animals. Reference: Abrahante JE, et al. Dev Cell. 2003 May;4(5):625-37. |
|
| SYS641 |
C. elegans |
ujIs113 II; hbl-1(dev198([hbl-1::mNeonGreen]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of hbl-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1. |
|
| TAM109 |
C. elegans |
ramTi3 II. Show Description
ramTi3 [ubl-1::mCherry::pri-mir-58 + Cbr-unc-119(+)] II. mCherry-based sensor for pri-miR-58 processing. Weak ubiquitous mCherry fluorescence. MosSCI insertion. Previously described as ram3. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566. |
|
| TLG697 |
C. elegans |
texIs127 X. Show Description
texIs127 [spp-9p::GFP] X. GFP expression in intestine and six aphid neurons, including AWB and AWC, serves as a reporter for DBL-1 signaling (fluorescence is high when DBL-1 signaling is low, and low when DBL-1 signaling is high). This reporter is also responsive to starvation, select bacterial pathogens, and loss of other innate immune signaling pathways, including tir-1 and pmk-1 (but not sek-1 or mek-1). texIs127 created by X-ray integration of extrachromosomal array wkEx52 into N2 animals using UV/TMP. Out-crossed five times to the N2. References: Lakdawala ML, et al. Mol Biol Cell. 2019 Dec 15;30(26):3151-3160. doi: 10.1091/mbc.E19-09-0500. PMID: 31693440. Roberts AF, et al. 2010 Jun 7:10:61. doi: 10.1186/1471-213X-10-61. PMID: 20529267. |
|
| VC1770 |
C. elegans |
Y73B6BL.1(ok2308) IV/nT1 [qIs51] (IV;V). Show Description
Y73B6BL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2308 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAGAAGAGTACGCAGC. External right primer: GCATAAAAATTCCTGCCTGC. Internal left primer: CGGAATCCGAAAATGCATAC. Internal right primer: AGCTTTCCCCCGATTGTACT. Internal WT amplicon: 3151 bp. Deletion size: 1058 bp. Deletion left flank: GAAAATAAATTGAAAAATAATTTTTCAGGG. Deletion right flank: TAACAAGTTATAGCCGCAATGAATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC3044 |
C. elegans |
dbl-1(ok3749) V. Show Description
T25F10.2. External left primer: TCCGACTTTTCAGCCTGATT. External right primer: AGCATCGTAGCCCTCTGAAA. Internal left primer: GATATGTCCAGTGGCTGCCT. Internal right primer: CTCACTGGGTGCCATAATCC. Internal WT amplicon: 1134 bp. Deletion size: 783 bp. Deletion left flank: CCAATGTCTGCTGCTGCCGATCAACACGCG. Deletion right flank: AAAAAATCGAAAAAAGGTTTGTGATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC4828 |
C. elegans |
Y92H12BL.1(gk5896[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 11570 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GGTGTTAAGCAGATTGATCGAATTGTTGAA. Right flanking sequence: GTTTATGGTAGCGGTATTGATTTTTCTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| VC642 |
C. elegans |
fbl-1(gk295) IV/nT1 [qIs51] (IV;V). Show Description
F56H11.1a. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk295 homozygotes (some make it to sterile adults). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VT1142 |
C. elegans |
nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA). |
|
| VT1146 |
C. elegans |
nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA). |
|
| VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. |
|
| VT3751 |
C. elegans |
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4. |
|
| VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21). |
|