Strain Information
Name | RG3005 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | Y65B4BL.1(ve505[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Description | unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Emily Lorenz-Mueller |
Laboratory | RG |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.