Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PHX2172 C. elegans sin-3(syb2172) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP syb2172 homozygotes (maternal effect sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. syb2172 is CRISPR-engineered deletion removing the ATG start codon and entire sin-3 coding region. Reference: Robert VJ, et al. Development. 2023 Oct 17;150(21):dev201755. doi: 10.1242/dev.201755 PMID: 37818613.
PHX4122 C. elegans tsp-6(syb4122[tsp-6::wrmScarlet]) X. Show Description
wrmScarlet tag inserted at C-terminus of endogenous tsp-6 locus. wrmScarlet expression in ciliated neurons provides a useful marker to track ciliary production of extracellular vesicles. Reference: Razzauti A & Laurent P. Elife. 2021 Sep 17:10:e67670. doi: 10.7554/eLife.67670. PMID: 34533135.
PHX5270 C. elegans ctns-1(syb5270[ctns-1::wrmScarlet]) II. Show Description
wrmScarlet tag inserted at C-terminus of endogenous stns-1 locus. Lysosomal marker. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.
PHX5321 C. elegans bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX5400 C. elegans golg-5(syb5400[golg-5::wrmScarlet]) I. Show Description
wrmScarlet tag inserted at the C-terminus of the endogenous golg-5 locus by CRISPR. Broad punctate expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6547 C elegans golg-4(syb6547[wrmScarlet::golg-4]) III. Show Description
wrmScarlet tag inserted at the N-terminus of the endogenous golg-4 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
PHX6680 C elegans golg-2(syb6680[wrmScarlet::golg-2]) II. Show Description
wrmScarlet tag inserted at the N-terminus of the endogenous golg-2 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX731 C. elegans vha-13(syb731[wrmScarlet::vha-13]) V. Show Description
wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.
PHX7380 C. elegans cone-1(syb7380[wrmScarlet::cone-1]) III. Show Description
Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX7515 C elegans dve-1(syb7515[dve-1::AID*::mScarlet]) X. Show Description
AID*::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357.
PHX8127 C. elegans srm-1(syb8127[unc-25p(fragment)::SL1-aaaa::FLP D5::let-858 3’UTR]) IV. Show Description
srm-1(syb8127[dpy-10 sgRNAsite::unc-25 fragment with tataa sites::dpy-10 sgRNAsite::SL1-aaaa::FLP D5::let-858 3’utr]) (IV:5015000). FLP D5 recombinase driver expressed from a fragment of the unc-25 promoter that expresses in RME neurons. Recombination was only modestly penetrant. Promoter construct contains dpy-10 sites allowing for a straightforward exchange of the promoter. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX8406 C. elegans tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I. Show Description
WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8810 C. elegans tol-1(syb8810[tol-1 Q712A,Y713A,G714A,N715A] *syb8406) I. Show Description
CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reduced brood size, high levels of embryonic and larval arrest. syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PJ1062 C. elegans let-60(n1046) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V.
PJ1063 C. elegans let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and are almost sterile (brood size is 6).
PJ1065 C. elegans let-60(n2021) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul/Egl. ras loss-of-signal.
PJ1069 C. elegans let-60(sy93) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dominant Vul allele, however, worms appear to be Egl and have multiple pseudovulvae (due to sup-7??).
PJ1077 C. elegans let-60(ga89) IV; lwIs16 X. Show Description
lwIs16 [act-4::lacZ] X. Temperature sensitive gain-of-function allele of ras. At high temperatures worms become Clr. Should also become Muv- not noted. Maintain at 16C.
PJ1093 C. elegans let-60(ga89) IV; ccIs55 V; gap-1(n1329) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Strain is viable at 15-25C. let-60(ga89) is temperature sensitive; however, with the gap-1 in the background the animals still appear somewhat Clr and Muv even at low temperatures.
PJ1099 C. elegans lin-45(sy96) let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul. Non-Clr at 25C. Poor growers (sub-viable?) at 25C.
PJ1100 C. elegans him-1(e879) I; let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and almost sterile (brood size is 6). Males appear to mate poorly - not quantitatively measured but very poor success with matings.
PJ1105 C. elegans mek-2(ku114) I; let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Occasional bags and L1 lethality. ga89 is temperature sensitive. Maintain at 16C.
PJ1107 C. elegans soc-2(n1774) let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Appear to have DV and bags with some frequencey. Appear to give Clr phenotype at 16C. Occasional Muv seen. Very frequently sterile due to lack of gonad development. Maintain at 16C.
PJ1109 C. elegans mpk-1(n2521) III; let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V.
PJ1121 C. elegans unc-4(e120) let-23(sa62) II; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. Muv.
PJ1153 C. elegans clr-1(e1745) II; let-756(s2613) unc-32(e189) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc. clr-1 is temperature-sensitive.
PJ1155 C. elegans let-756(s2613) unc-32(e189) III; ccIs55 V; egl-17(n1377) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egg laying defective. Moderate to severe bloating. >50% make bags of worms.
PJ1158 C. elegans clr-1(e1745) II; let-756(s2613) unc-32(e189) III; ccIs55 V; egl-17(n1377) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl: moderate to severe bloating. Clr-1 is ts. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc.
PJ821 C. elegans unc-4(e120) jDf4/unc-4(e120) let-257(mn235) II. Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and UncLets. Lethal in larval development. Also reference 710.
PQ320 C. elegans apIs320 II; unc-119(ed3) III. Show Description
apIs320 [let-7::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PQ402 C. elegans apIs402 II; unc-119(ed3) III. Show Description
apIs402 [let-7(delta alg-1-binding site)::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PQ404 C. elegans apIs404 II; unc-119(ed3) III. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PQ425 C. elegans apIs320 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PQ426 C. elegans apIs404 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PS1410 C. elegans let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC.
PS1411 C. elegans let-23(sy1) II; sli-1(sy143) X. Show Description
sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC.
PS1423 C. elegans let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC.
PS1524 C. elegans let-23(sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.
PS1839 C. elegans let-23(sa62) II. Show Description
Semi-dominant Muv.
PS21 C. elegans let-23(sy1) II; him-5(e1490) V. Show Description
Viable allele of let-23. Vul. Throws males. Do not distribute this strain; other labs should request it from the CGC.
PS2286 C. elegans unc-38(x20) lfe-2(sy326) I. Show Description
Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC.
PS2366 C. elegans itr-1(sy328) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
PS2368 C. elegans itr-1(sy327) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
PS2512 C. elegans itr-1(sy331) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
PS2516 C. elegans itr-1(sy291) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
PS2582 C. elegans itr-1(sy290) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.
PS2746 C. elegans dpy-20(e1282) IV; syEx234. Show Description
syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.
PS295 C. elegans let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
PS302 C. elegans let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
PS4064 C. elegans let-23(sy621sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are approximately wild-type in size and Muv. Pick Muv non-Unc (heterozygotes) to maintain.