| KR827 |
C. elegans |
let-363(h502) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early mid development.
|
|
| KR828 |
C. elegans |
let-577(h503) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.
|
|
| KR829 |
C. elegans |
let-625(h506) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.
|
|
| KR833 |
C. elegans |
let-578(h512) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.
|
|
| KR850 |
C. elegans |
let-615(h529) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in egg/early larval development.
|
|
| KR878 |
C. elegans |
let-643(h500) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.
|
|
| KR919 |
C. elegans |
let-571(h347) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.
|
|
| KR920 |
C. elegans |
let-619(h348) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early mid development.
|
|
| KRA867 |
C. elegans |
tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I; lat-1(syb8408[lat-1(before 651 aa)aaaaA::EGFP::linker::3xFLAG::aaaaA]) II. Show Description
syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
|
|
| KRA868 |
C. elegans |
tol-1(syb8810[tol-1 Q712A,Y713A,G714A,N715A] *syb8406) I/+; lat-1(syb8955[lat-1 F69A] *syb8408) II. Show Description
CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development; syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Engineered F69A mutation in endogenously-tagged lat-1 locus; syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa.
Homozygous lat-1(syb8955;syb8408) animals harboring heterozygous tol-1(syb8810;syb8406)/+. Animals exhibit reduced brood sizes and delayed development. Animals segregate into lat-1(syb8955;syb8408);tol-1(syb8810;syb8406) homozygotes, which are lethal; lat-1(syb8955;syb8408);tol-1(syb8810;syb8406)/+ heterozygotes, and lat-1(syb8955;syb8408);+/+, which have slightly reduced brood sizes. To maintain, pick EGFP(+) progeny.
|
|
| KRA869 |
C. elegans |
tol-1(syb8810[tol-1 Q712A,Y713A,G714A,N715A] *syb8406) I; lat-1(syb8955[lat-1 F69A] *syb8408)/+ II. Show Description
CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development; syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Engineered F69A mutation in endogenously-tagged lat-1 locus; syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa.
Homozygous tol-1(syb8810;syb8406) animals harboring heterozygous lat-1(syb8955;syb8408)/+ . Animals exhibit reduced brood sizes and high levels of embryonic and larval arrest. Animals segregate into lat-1(syb8955;syb8408);tol-1(syb8810;syb8406) homozygotes, which are lethal; lat-1(syb8955;syb8408)/+;tol-1(syb8810;syb8406) heterozygotes, and +/+;tol-1(syb8810;syb8406) which have reduced brood size and exhibit embryonic and larval lethality.
|
|
| KW2204 |
C. elegans |
cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi20 II. Show Description
ckSi20 [cdk-9::mCherry::mex-5 3"UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi20 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
|
|
| LD1008 |
C. elegans |
ldEx9. Show Description
ldEx9 [skn-1(operon)::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: Tullet JM, et al. Cell. 2008 Mar 21;132(6):1025-38.
|
|
| LL1009 |
C. elegans |
hsp-90(nr2081)/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and arrested larvae. Published as LL1008. Previously known as daf-21.
|
|
| LP815 |
C. elegans |
cpIs158 I; cpIs130 II; egl-20(cp400[egl-20::YPET::3xFlag]) IV. Show Description
cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| LP896 |
C. elegans |
unc-94(cp439[unc-94::mNG-C1]) I; cap-1(cp436[mScarlet-I-C1::cap-1]) IV. Show Description
mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
| LSD1091 |
C. elegans |
smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| LSD1097 |
C. elegans |
smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| LSD2104 |
C. elegans |
xchIs15. Show Description
xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.
|
|
| ME487 |
C. briggsae |
Cbr-let-7(ae48) X. Show Description
Egg-laying defects, sometimes burst at vulva. Extra molts. ae48 deletion that removes structural parts and an essential seed sequence of let-7 miRNA (null allele). WT: ATTTTTCAGGGGATTGCAGGATGATGGCTCTACACTGGGGTACGGTGAGGTAGTAGGTTGTATAGTTTAG; ae48: ATTTTTCAGGGTATAGTTTAG. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
|
|
| ME489 |
C. briggsae |
Cbr-lin-14(ae51) Cbr-let-7(ae50) X. Show Description
Putative null alleles of Cbr-lin-14 and Cbr-let-7. Cbr-lin-14: WT: GAGGTTCACGATCTACGGACGGCAGTAAAT; ae51: GAGGTTCACGATCACGACGGACGGCAGTAAAT. Cbr-let-7 WT: ATTTTTCAGGGGATTGCAGGATGATGGCTCTACACTGGGGTACGGTGAGGTAGTAGGTTGTATAGTTTAG; ae50: ATTTTTCAGGGGATTGCAGGATGTATAGTTTA. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
|
|
| ME553 |
C. briggsae |
aeIs15 II; Cbr-mir-241 Cbr-mir-48(ae73) V; Cbr-hbl-1(aeIs12[Cbr-hbl-1::AID]) Cbr-mir-84(ae70) X. Show Description
aeIs15 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. AID tag inserted at C-termini of endogenous hbl-1 locus. Heterochronic defects (increased number of seam cells, patchy alae, bursting at vulva at adulthood). Weak heterochronic in the presence of 5-Ph-IAA. Putative null alleles of let-7 family miRNAs Cbr-mir-241, Cbr-mir-48, and Cbr-mir-84. ae73: AAATGCACGTATAGGATGGGCTTCT<12,897 bp del>CGGGTTGGGACACAAACAACTCTTT. ae70: TTTTGAACAGCCGAGGAA-------TGATGTTGACTTTTCAGTTACGTC. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
|
|
| ME564 |
C. briggsae |
Cbr-lin-4(ae79) aeIs15 II; Cbr-mir-241 Cbr-mir-48(ae73) V; Cbr-hbl-1(aeIs12[Cbr-hbl-1::AID]) Cbr-mir-84(ae70) X. Show Description
aeIs15 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. AID tag inserted at C-termini of endogenous hbl-1 locus. Vulvaless with heterochronic defects (increased number of seam cells and incomplete adult alae). Heterochronic phenotypes are suppressed in the presence of 5-Ph-IAA. ae79 deletion removes structural parts and an essential seed sequence of Cbr-lin-4. Putative null alleles of let-7 family miRNAs Cbr-mir-241, Cbr-mir-48, and Cbr-mir-84. ae73: AAATGCACGTATAGGATGGGCTTCT<12,897 bp del>CGGGTTGGGACACAAACAACTCTTT. ae70: TTTTGAACAGCCGAGGAA-------TGATGTTGACTTTTCAGTTACGTC. ae79: GCC------CTGAGACCTCAAGTGTGAGCGTTCTGAACAT. Reference: Ivanova M & Moss EG. Genetics. 2023 Oct 3:iyad177. doi: 10.1093/genetics/iyad177. PMID: 37788363.
|
|
| MG827 |
C. elegans |
unc-119(ed3) III; xsSi36 IV. Show Description
xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.] Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.
|
|
| MH1019 |
C. elegans |
soc-2(ku167) IV. Show Description
No obvious phenotype alone. ku167 suppresses let-60(n1046). Previously called sur-8.
|
|
| MH1131 |
C. elegans |
soc-2(ku167) let-60(n1046) IV. Show Description
Less than 5% Muv. Previously called sur-8(ku167).
|
|
| MH17 |
C. elegans |
sur-2(ku9) I. Show Description
100% bag of worms. Low percentage of dead larvae. Slightly dumpy. ku9 completely suppresses let-60(n1046) Muv phenotype.
|
|
| MH2285 |
C. elegans |
lin-66(ku423) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ku423 homozygotes have delayed heterochronic phenotype and are L4 lethal.
|
|
| MH231 |
C. elegans |
let-60(n1046) IV; ksr-1(ku68) X. Show Description
Semi-dominant suppressor of let-60(n1046). Strong reduction of function mutation. At 20C: <1% Muv, 24% Egl, 6% larval lethal, and SM migration defects.
|
|
| MH2430 |
C. elegans |
cbp-1(ku258) III. Show Description
Semidominant suppressor of let-60(n1046).
|
|
| MH351 |
C. elegans |
let-60(sy101sy127)/dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and lethals.
|
|
| MH538 |
C. elegans |
mek-2(ku114) I; let-60(n1046) IV. Show Description
|
|
| MH801 |
C. elegans |
sur-7(ku119) X. Show Description
No obvious morphological phenotype on its own. Good suppressor of Muv of let-60(n1046).
|
|
| ML2501 |
C. elegans |
let-805(mc73[let-805::gfp + unc-119(+)]) unc-119(ed3) III. Show Description
Superficially wild-type. mc73 was generated by using Crispr/Cas9 to add a GFP tag to the endogenous let-805 locus and also insert a rescuing unc-119 transgene. Reference: Quentin S, et al. Development 2016 143: 160-173; doi: 10.1242/dev.126615.
|
|
| ML2578 |
C. elegans |
let-4(mc95[let-4::GFP]) X. Show Description
GFP tag inserted into endogenous let-4 locus using CRISPR/Cas9. Reference: Vuong-Brender TTK, et al. Development. 2017 Dec 1;144(23):4336-4349. doi: 10.1242/dev.150383. PMID: 28526752.
|
|
| MLC1480 |
C. elegans |
lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MQG17 |
C. elegans |
lin-5(ev571) II; oxTi719 unc-119(ed3) III; let-99(or204) IV. Show Description
Temperature-sensitive embryonic lethality and hermaphrodite sterility. Defective mitosis, abnormal cytokinesis. Nonviable at 15C. Also sick (<50% viability) at 12C. The let-99(or204ts) mutant is cold-sensitive as well as heat-sensitive (MQG, unpublished). MQG17 is less cold-sensitive than its parent strain EU1472 let-99(or204).
|
|
| MSB1041 |
C. elegans |
bus-17(br2) X; mirIs92. Show Description
mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
|
|
| MSB273 |
C elegans |
syIs423 V; mirIs19. Show Description
syIs423 [15xUAS::Δpes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MSB555 |
C elegans |
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Show Description
wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MSB861 |
C. elegans |
mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB952 |
C. elegans |
mirIs97 [*oxTi677] II; unc-119(ed3) III. Show Description
mirIs97 [15XUAS::ACR1::let-858 3'UTR *oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] II. Superficially wildtype. Integration of multicopy UAS::ACR1 array into tdTomato in the oxTi677 insertion. Genotype for UAS::ACR1 with primers 5'-atgagcagcatcacctgtgat-3' and 5'-ttaggtctcgccggctct-3' to obtain a ~900 bp band.
|
|
| MSB961 |
C. elegans |
mirSi29 II; unc-119(ed3) III. Show Description
mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB966 |
C. elegans |
mirSi34 II; unc-119(ed3) III. Show Description
mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB985 |
C. elegans |
mirSi37 II; unc-119(ed3) III. Show Description
mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MT11713 |
C. elegans |
mep-1(n3702) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, PvlSte, and dead eggs.
|
|
| MT12755 |
C. elegans |
ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
|
|
| MT14390 |
C. elegans |
let-418(n3536) V. Show Description
Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.
|
|
| MT1679 |
C. elegans |
unc-105(n490) II; lon-2(e678) let-2(n821) X. Show Description
Long. n821 pka sup-20(n821).
|
|
| MT1720 |
C. elegans |
unc-105(n490) II; let-2(n821) X. Show Description
n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.
|
|