ABR161 |
C. elegans |
hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
|
|
ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
AC365 |
C. elegans |
sao-1(ok3335) V. Show Description
Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
|
|
AD294 |
C. elegans |
cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
|
|
AE501 |
C. elegans |
nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
|
|
AGK233 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
AGK234 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
AGK532 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
AML318 |
C. elegans |
otIs669 V. Show Description
Derived by out-crossing parental strain OH15262 an additional six times to N2. Out-crossed strain AML318 seems healthier than parental strain when maintaining long-term under normal conditions (AML observed an increase in male and sterile progeny in parental strain in successive generations.) otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642.
|
|
AU37 |
C. elegans |
glp-4(bn2) I; sek-1(km4) X. Show Description
Temperature sensitive sterility. Maintain at 15C. Enhanced sensitivity to pathogens.
|
|
AV106 |
C. elegans |
spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny.
|
|
AWR41 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR45 |
C. elegans |
pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AWR54 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR56 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR58 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR59 |
C. elegans |
keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AWR61 |
C. elegans |
keaSi11 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AWR62 |
C. elegans |
keaSi9 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AWR63 |
C. elegans |
keaSi12 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AWR64 |
C. elegans |
kea15 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AY161 |
C. elegans |
mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ?1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
|
|
BC1519 |
C. elegans |
dpy-18(e364)/eT1 III; sDf31/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Original isolation: BO strain BC1261 unc-22(s727) hermaphrodite heat shocked for 1 hour at 34C. Crossed to N2 strain BC1270 unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Picked individual WT hermaphrodites. Screened for the absence of gravid Unc-22. Retained strain as BC1379. Balanced over eT1: BC1379 unc-22(s727)[BO]/nT1[N2] IV; sDf31[BO]/nT1[N2] hermaphrodite crossed to BC 1265 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Pick WT hermaphrodites that twitch in 1% nicotine. Retained one strain that segregated Unc-36 as BC1428. Pseudolinked sDf31 to dpy-18: BC1428 +/eT1 III; sDf31[BO]/eT1 V crossed to BC 1265 dpy-18/eT1 III; unc-46/eT1 V male. Picked WT hermaphrodite F1. From strains segregating Unc-36 but no Dpy or Unc-46 or DpyUnc-46, cross WT hermaphrodites to BC1265 males. From strains producing Dpy, crossed individual WT males to BC70 eT1;eT1. From each cross, crossed WT X WT. Kept one strain producing on Dpy or DpyUncs as S-H716 male. Picked one hermaphrodite to start BC1519. Comments: 1) The LGV region balanced by eT1 should be all BO. 2) Probably the rest of the genome still has a considerable amount from BO since it was crossed to N2 only 4 times. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC4390 |
C. elegans |
sEx776. Show Description
sEx776 [C05A2 (V) + pCes1943[rol-6(su1006)]]. "Low" amount of cosmid C05A2 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4542 |
C. elegans |
sEx29. Show Description
sEx29 [ZK652 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK652 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4544 |
C. elegans |
sEx31. Show Description
sEx31 [ZK688 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK688 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4545 |
C. elegans |
sEx32. Show Description
sEx32 [T20H4 (III) + pCes1943[rol-6(su1006)]]. T20H4 + pCes1943[rol-6(su1006dm)] injected into N2 hermaphrodite. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4566 |
C. elegans |
sEx34. Show Description
sEx34 [T21D11 (III) + pCes1943[rol-6(su1006)]]. Cosmid T21D11 + pCes1943[rol-6(su1006dm)] injected into N2 hermaphrodite. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4583 |
C. elegans |
sEx37. Show Description
sEx37 [C06G4 (III) + pCes1943[rol-6(su1006)]]. Cosmid C06G4 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4585 |
C. elegans |
sEx39. Show Description
sEx39 [K06H7 (III) + pCes1943[rol-6(su1006)]]. Cosmid K06H7 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4604 |
C. elegans |
sEx50. Show Description
sEx50 [F44B9 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul F44B9 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4649 |
C. elegans |
sEx67. Show Description
sEx67 [R151 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 20 ng/ul R151 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4650 |
C. elegans |
sEx68. Show Description
sEx68 [R13A5 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul R13A5 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4652 |
C. elegans |
sEx70. Show Description
sEx70 [T20B12 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 20 ng/ul T20B12 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4655 |
C. elegans |
sEx73. Show Description
sEx73 [F08F8 (III) + pCes1943[rol-6(su1006)]]. segrgnt 3. 20 ng/ul F08F8 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4660 |
C. elegans |
sEx76. Show Description
sEx76 [C30C5 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul C30C5 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4662 |
C. elegans |
sEx77. Show Description
sEx77 [F56C9 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 20 ng/ul F56C9 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4665 |
C. elegans |
sEx81. Show Description
sEx81 [F37C12 (III) + pCes1943[rol-6(su1006)]]. segrgnt 5. 20 ng/ul F37C12 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4666 |
C. elegans |
sEx82. Show Description
sEx82 [T04A6 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 20 ng/ul T04A6 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4667 |
C. elegans |
sEx83. Show Description
sEx83 [C18H2 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 20 ng/ul C18H2 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4694 |
C. elegans |
sEx95. Show Description
sEx95 [C14B9 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul C14B9 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4699 |
C. elegans |
sEx90. Show Description
sEx90 [D2007 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 5. 20 ng/ul D2007 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4700 |
C. elegans |
sEx91. Show Description
sEx91 [C29E4 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 20 ng/ul C29E4 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4738 |
C. elegans |
sEx778. Show Description
sEx778 [B0379 (I) + pCes1943[rol-6(su1006)]]. line 1. "Low" amount of cosmid B0379 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4785 |
C. elegans |
sEx114. Show Description
sEx114 [C06E8 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 2. 10.6 ng/ul C06E8 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4787 |
C. elegans |
sEx111. Show Description
sEx111 [F11H8 (III) + pCes1943[rol-6(su1006)]]. segrgnt 4. 20 ng/ul F11H8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4798 |
C. elegans |
sEx119. Show Description
sEx119 [K04C2 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul K04C2 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4816 |
C. elegans |
sEx121. Show Description
sEx121 [R13F6 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul R13F6 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4885 |
C. elegans |
sEx124. Show Description
sEx124 [K07E12 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 20 ng/ul K07E12 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC4890 |
C. elegans |
sEx126. Show Description
sEx126 [K03F8 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 20 ng/ul K03F8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|