Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
MJ69 C. elegans emb-8(hc69) III. Show Description
ts embryonic lethal. Grows at 15C. Does not grow reliably at 20C. Lethal at 25C.
SOZ511 C. elegans emb-8(ssd89) III. Show Description
emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
GE3023 C. elegans emb-8(t1533) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.