Isolated from a pineapple field in Hawaii in 1972 by L. Hollen. Wild type. Low copy Tc1; pattern IX. C. elegans wild isolate. CB subclone of HA-8 (Tc1 pattern IX). See also WBPaper00005369. [NOTE (4-2014): Users reported abnormalities in CB4856 in late 2013 and early 2014. The current working stock at the CGC was thawed in 2-2014 from stock frozen in 1995.]

kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing.

pgIR6 (X, CB4856>N2). CB4856 Chromosome X in N2 background.

pgIR2 (II, CB4856>N2). CB4856 Chromosome II in N2 background.

pgIR3 (III, CB4856>N2). CB4856 Chromosome III in N2 background.

pgIR4 (IV, CB4856>N2). CB4856 Chromosome IV in N2 background.

pgIR5 (V, CB4856>N2). CB4856 Chromosome V in N2 background.

Reduced lifespan and reduced mitochondrial membrane potential. Transmitochondrial cybrid worm strain was bred to be homoplasmic for the CB4856 mtDNA genome in the N2 nuclear background. Reference: Dingley SD, et al. J Mol Biol. 2014 May 29;426(11):2199-216.

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).

qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.

pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background.

Isolated from Hawaiian strain CB4856. Temperature sensitive embryonic lethal. Cytokinesis failure and polarity defects at 25C. Maintain at 15C. RNAi sensitive.

Isolated from Hawaiian strain CB4856. Temperature sensitive embryonic lethal. Cytokinesis failure and polarity defects at 25C. Maintain at 15C. RNAi sensitive.