Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GG19 C. elegans div-1(g19) III. Show Description
Maintain at 15C. Temperature sensitive. Will grow at 20C, but does better at 15C (viable, somewhat Unc). At 25C: 91% of eggs arrest at lima bean.
CG197 C. elegans egl-2(rg4) him-5(e1490) V. Show Description
No longer able to suppress male muscle seizures in the absence of food.
EG199 C. elegans nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
OH20507 C. briggsae otSi10 V. Show Description
otSi10 [eft-3p::tdTomato::H2B::tbb-2 3'UTR] V. Maintain at 25C. FLInt Safe Harbor landing site for one-shot targeted transgenic array integration into chromosome V of C. briggsae. Generated in parental strain AF16. otSi109 is a CRISPR-mediated insertion into the intergenic region between genes CBG19020 and CBG27145, homologous to the oxTi553 tdTomato insertion site in C. elegans strain EG7944.
SHG1936 C. elegans ego-1(ust356[mCherry::ego-1]) I. Show Description
mCherry inserted into endogenous ego-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
SHG1941 C. elegans ustSi268 I. Show Description
ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
VT3805 C. elegans maIs105 V; alg-1(ma443) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT3809 C. elegans alg-1(ma443) X. Show Description
Maintain at 20C. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.