More Fields
Strain Species Genotype
GG19 C. elegans div-1(g19) III. Show Description
Temperature sensitive. At 25C: 91% of eggs arrest at lima bean. At 16C: Viable, somewhat Unc. Will grow at 20C.
CG197 C. elegans egl-2(rg4) him-5(e1490) V. Show Description
No longer able to suppress male muscle seizures in the absence of food.
EG199 C. elegans nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.