More Fields
Strain Species Genotype
RG3103 C. elegans +/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
GL390 C. elegans aco-2(rf40[aco-2::GFP]) III. Show Description
C-terminal GFP tag inserted into endogenous aco-2 locus. ACO-2::GFP is a mitochondrial marker allowing the examination of native mitochondrial morphology in live animals. Reference: Begelman DV, et al. 2022 Jul 17;2022:10.17912/micropub.biology.000599. doi: 10.17912/micropub.biology.000599. eCollection 2022. PMID: 35903774