Strain Information
| Name | GLW16 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | rab-7(utx12[mNG::rab-7]) II. |
| Description | Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3' |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Bailey de Jesus (Glow Worms '21) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.