Strain Information
Name | GLW19 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | mpk-1(utx14[mNG::mpk-1]) III. |
Description | Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3' |
Mutagen | CRISPR/Cas9 homologous recombination |
Outcrossed | x0 |
Made by | Alex Koh (Glow Worms '20) |
Laboratory | GLW |
Reference | N/A |
Sign in
or
register an account if you want to order this strain.